na +_- me

 

 

me Rem ager TOE RE

[

|

 

ane pe: Pemrenagto ite mnt

  

‘

S

=

Sy
tc

W
Vig

Y
\

LZ
‘el 5 >)
ee

A DESMAN

 

 

Volume XIII.

Commercial Reports
and Collections....

For the Commercial Standing of indiv-
iduals, or to have yourclaims collected,
eall Telephones 166 or 1030.
COMMERCIAL CREDIT CO., Limited.
Widdicomb Bldg., Grand Rapids, Mich.

 

 

$ ie
THE
°° . 4
o FIRE 3
; , INS. $
$ 7? — 2
° Sd
r Prompt, Conservative, Safe. . 4
J.W.CHAMPLIN, Pres. W. FRED McBarn, Sec. @
9900000 0000000000000000

 

Columbian Transfer Company

CARRIAGES
BAGGAGE and
FREIGHT WAGONS

15 and 17 North Waterloo St.
Telephone 381-1.

————

 

Martin DeWright. J. Renihan, Counsel.

The Michigan
Mercantile Company

3 & 4 Tower Block, Grand Rapids.
Correspondence solicited. Law and collections.
Reference furnished upon application.

The [Michigan
Trust Co., fe

Acts as Executor, Administrator
Guardian, Trustee.
Send for copy of our pamphlet ‘‘Laws of the

State of Michigan on Descent and Distribution

of Property.”

INSURANCE CO.
Detroit, Mich.

 

Organized
1881

 

Grand Rapids.

Grand Rapids,
rn

 

GRAND RAPIDS, WEDNESDAY, MARCH 18, 1896.

SUCCESSFUL SALESMEN.

&. E

 

of the Koffa-Aid Co.,
Detroit.

Born at Syracuse, N. Y., Jan. 10,1854,
of American parents, moved. to
Fayetteville, N. Y., in 1857, where Mr.
Bowen entered the public school at 5
years of age. In 1865 his parents moved
West and settled in Grass Lake, Jack-
son countyt Michigan, where they still

Bowen,

who

reside, his father being engaged in
mercantile business. Mr. Bowen at-

tended the high school at Grass Lake,
where he graduated at 18 years of age,
and then took a course at the Michigan
University. Upon leaving Ann Arbor,
he chose a mercantile career, and, in
order the better to fit himself for a busi-
ness career, he took a course at Bryant
& Stratton’s Business Colleze, Detroit,

 

 

 

 

 

Country Merchants
Can save exchange by keeping their Bank
accounts inGrand Rapids, asGrand Rapids

checks are parin all markets. The

NICH

Offers exceptional facilities to its custom-
ere, and is prepared to extend any favors
consistent with sound banking.

DANIEL McCOY, President.
CHAS. F. PIKE, Cashier.

 

The.cccee
PREFERRED
BANKERS
LIFE
ASSURANCE
COMPANY

.-100f MICHIGAN

Incorporated by 100 Michigan Bankers. Pays,
all death claims promptly and in full. This
Company sold Two and One-half Millions of In-
surance in Michigan in 1895, and is being ad-
mitted into seven of the Northwestern States at
this time. The most desirable plan before vhe
people. Sound and Cheap.

Home office, LANSING, Michigan.

TRADESMAN COUPONS

 

Save Trouble
Save Losses
Save Dollars

 

 

after which he decided to go West and,
in April, 1878, went to Omaha, Neb.,
and accepted a position as book-keeper
in a wholesale and retail jewelry and
music house, where he remained three
years and a half, leaving them to ac-
cept the position of head book-keeper
in the Auditor’s office of the Pacific
Express Co.’s general offices, which are
located in Omaha, where he remained
about. two years. During these five
years and a half he had accumulated
several thousand dollars in reai estate
speculation, but, in a business venture
with others which turned out badly, he
lost nearly everything. This did not
discourage him and, having that Amer-
ican pluck and energy which are so es-
sential to final success, he went to work
to get another start. Continued office
work having impaired his health, he
accepted a position with a wholesale
tea, spice and cigar house to represent
them in Southern Nebraska. This he
successfully did until the house finally
moved to St. Joseph, Mo., and consoli-
dated with another house. He then ac-
cepted a position with Steele & Walk-
er, wholesale grocers of St. Joseph,
and represented them in Southern

|

Kansas for about two years. Preferring
to travel in Nebraska, he
Omaha and accepted a_ position with
Sloan, Johnson & Co., wholesale gro-
cers, and represented them in his old
territory in Southern Nebraska. He
finally gave up traveling and established
himself in the merchandise brokerage
Omaha. After about two
years, his health having
failed him, he disposed of his business
and removed with his wife to his old
home, at Grass Lake, to recuperate and
regain his health, which he did after
several months. He then determined
to remain in the East and, in March,
1890, went to Detroit and engaged in
the merchandise brokerage
continuing the same about three and
one-half years, at the end of which
time, having been offered the general
agency for Ohio and Michigan, also
Buffalo and
Blackledge Co., of Indianapolis, to look
after its jobbing interests, he accepted
the position and represented them until

business in

and one-half

business,

July 1, 1895, with headquarters at De-
troit. He then severed his connection
with the Mullen-Blackledge Co. and

entered into partnership with Harry J.
Purse, of Detroit, and they established
the Koffa-Aid Co., with headquarters at
112 Jefferson avenue, Detroit, for the
manufacture of Koffa-Aid, which is
having a large sale and becoming very
popular upon the market, Mr. Bowen
looking after the outside affairs of the
company.

Mr. Bowen owes allegiance to the
Masonic order, also to the Knights of
Pythias and attends the Presbyterian
| church,

He was married at Lincoln, Neb.,
in Dec., 1885, to Miss Julia Browning,
formerly of Maysville, Ky., whose an-
tecedents are all Kentucky people.

Mr. attributes
natural energy and ability, and his ex-
tended acquaintance with the jobbing
grocery trade which he: gained during
the past years of his life on the road
will be of much value to him.

—
FLAG FOOLS.

A Kansas City merchant, whose pa-
triotism is of the effervescent soda pop
brand, which makes a great fizz, but
has little substance in it, has provided
himself with a quantity of Spanish flags,
one of which he burns in public every
night. It is said the act is highly ap-
plauded by other patriots of like cal-
ibre, who thus trample on the Spanish
flag. It isa silly and childish thing to
do. People in Kansas City, or the
Princeton students, are entirely safe in
insulting the Spanish flag when they
are thousands of miles from Spanish
bullets. If they were at closer range
there might be a_ spice of dare-devil
bravery in it; but, when they are safe
at home, it is a ridiculous pose of de-
fiance. A Kansas City man _ insulting
the Spanish flag in his own stockyard
could give a Don Quixote fighting wind
mills odds on making himself a figure
of fun. If any American gentlemen
have anything against the Spanish flag,
let them go to Cuba and join the revo-
lutionists. Then, when they burn the

Bowen his success to

 

returned to |

Pittsburg, by the Mullen- |

Number 652

Spanish flag, it will mean something.
Also, let the bibulous braggarts of Bar-
celona, and other places in
are trampling the American flag
their feet, come on American soil and
They are all idiots
and less warriors than the small boy in

Spain, who
under

show themselves.

one backyard who makes faces to an-
other small boy in another backyard.
a

| EDUCATIONAL IMMIGRANT TEST.
One of the

presented for

Congress is

clusion of

most important matters
the consideration of this
the Lodge bill for the ex-

illiterate immigrants, pre-

sented in the Senate last Monday. The
operation of the measure will exclude
but few of the more desirable national-

}

| ities, such as the English, German and

| French; but it will have great signiti-
| cance with the Italians, Russians,
| Poles, Hungarians, Greeks and Asiat-
ics

|

Aside from the general proposition
that it is than foolish for this
country to
the its own youth to be
counteracted by the intlux of the illiter-
the Old World, there is
sufficient specific reason for the enact-
ment of such a measure in its influence
in industrial matters. Some of the
serious labor disturbances, espe-

worse

enact and enforce laws for

education of

ate scum of

most
cially in the mining regions, have been
race the conditions for
which would have been impossible un-
der the operation of such a law; and
when it is recalled how
and bloodshed
the importance of the measure will re-
But these are only lo-
cal indications of conditions obtaining
in ail parts of the country, the increase
of which demands the most prompt and
effective especially in the

disturbances,

much of dis-

order these have cost,

ceive emphasis.

prevention,

larger cities.
~oe
BANE OF THE MERCHANT.

All merchants know the difficulty in
dealing with people who return articles
they have purchased. They are weak-
minded and vacillating shoppers who
always are dissatisfied with what they
get, and who would like to exchange it
for something else. If they bought
shoes, they come back the next day to
swap them for slippers, and if they get
a silk gown, they want it changed fora
spring bonnet. When they get to heaven

they possibly will want to get their
crown taken back and a harp given
them in place of it, They are never
satisfied, and are among. the bargain-

counter trials of a merchant’s life. In
Chicago, where people are becoming
cultivated and exclusive, a merchant
in one of the big up-town department
stores has found it necessary to put up
for the benefit of this class of customers

the tollowing sign: ‘‘We don’t take
back tooth-brushes which have been

used or things which would offend an-
other’s sense of daintiness to know they
were not fresh goods; but we do not
shirk our responsibility for such ar-
ticles. 7” i
a
A result of the harnessing of Niagara
is that Aluminum rolling ingots are re-
duced in price to 6 cents per pound in
ton lots. This metal is so light a ton
of it would present a considerable bulk.

 

 

THE MICHIGAN TRADESMAN

 

Bicycles —

Are High Prices a Sign of Prosperity?
Among the false doctrines in finance
and political economy which have
gained a large acceptance among many
classes of people, none is more perni-
cious than the notion that high prices
of the necessaries of lite are a sure
evidence of general prosperity.

This notion has largely been put for-
ward by demagogues who want to con-
trol the political influence of the farm-
ers and in that way has grown up the
idea that all the financial trouble in this
counrty has been caused by the low
prices of wheat and cotton and that
these low prices have not resulted from
excessive crops but from unfriendly leg-
islation by Congress.

High prices for the necessities of
life mean either that the supply is short
or that there are parties controlling the
supply who are able to lock it up or
hold it back so as to force the people to
pay exorbitant prices. In either case,
the masses of the people are the suffer-
ers; only when the crop is short they
are the victims’ of natural conditions;
while in the other case they are suffer-
ers at the hands of sharpers and specu-
jators.

When the prices of food and clothing
are low it means that the supplies of
those necessaries are abundant, which is
certainly a fortunate thing for the great
body of the people. In considering all
great questions of political economy,
only the masses—the great body of the
people who live by their labor, be it of
brain or muscle—are taken into ac-
count. The wealthy classes only come

nto the problem as exceptions, for it
really does not make any difference to
the millionaire whether he pays three
or six dollars tor a barrel of flour or five
or ten cents for a yard of cotton cloth;
but to the man who works for wages, the
doubling of the prices of his bread and
clothing becomes a most serious affair.

When prices of articles of universal
use are low, they are placed more in
the reach of the masses, and the con-
sumption will be proportionately great-
er. The greater the consumption, the
more. people will be employed in the
production of those articles, and the
greater the demand for laborers the
larger will be the wages paid.

But such an increase in production
and consumption necessitates that, in
order to market the same amount of
profit, a vastly larger business must be
done; while, if the production could be
limited and the prices forced up, the
desired profit could be made on a
smaller output. This idea is at the
bottom of all the powerful manufactur-
ing monopolies known as trusts, The
operation of such a monopoly 1s well
illustrated by John Nelson, in the March
number of the Magazine of Civics.

The argument is to this effect: Sup-
pose that an article is produced ata
cost of 80 cents and sold at $1; the
profit is 25 per cent. Put up the price
to $1.20 and sales will naturally fall off
one-fifth, but the profit on each sale
will be doubled. At the lower price
the sale of 100 of the articles will bring
in a profit of $20; after the advance in
price the sale of eighty will bring a
profit of $32, an increase of 60 per cent.
One-fifth of the men engaged in the in-
dustry will be thrown out of work. Are
those who retain their places as likely
to get more pay because of the increased
return to capital? On the contrary,
when they see one-fifth of their former

 

fellow-workmen out of a job they will
be glad for any wages they can get in
order to keep their places.

The temptation is always to get rich
by doing less work and with a smaller
outlay of money. When a number of
manufacturers make a combination to
close a certain proportion of their fac-
tories and cut down production, they
are able to force rp the prices of their
products, so that, with a reduced out-
lay of money and a smaller working
force, the combination can make just
as large a profit as when all the fac-
tories were working with full forces.
The same rule applies when a labor
union seeks to curtail production or in-
creases the price of an article by forc-
ing the price of labor beyond reasonable
limits or imposing restrictions which
honest manufacturers cannot submit to
in justice to themselves and the public.
All attempts to control natural trade
conditions are wrong in principle and
iniquitous in results.

The bicycle is becoming a most im-
portant article of daily use, taking in
many respects the place of a horse for
personal transportation. When the man-
ufacture of bicycles was controlled by
three or four persons, a wheel was sold
for $150, which was no better than one
which can be bought now for $75. In
consequence of the reduction, sales have
more than doubled, and the number of
bicycle-factory employes has increased
in the same proportion. As the same
amount of money that was formerly
spent for 100 bicycles will now buy 200,
and give work to twice as many men,
it is perfectly clear that competition in
that business has caused the employ-
ment of more labor, and whatever en-
larges the field of labor makes wages
better.

It comes to this, then, that the great-
est blow to labor is not in the low price
of the products of labor, but in the fact
that by the combination of manufactur-
ers or laborers into trusts, in order to
keep down production, so to be at all
times able to control the markets, many
factories are closed and their laborers
discharged. What is needed is open
competition and the largest possible
employment of labor in every industry,
and all necessaries at such low prices
as to put them in the easy reach of
everybody.

Such a system embodies the doctrine
of ‘‘quick sales and small profits,’’ in
contradistinction to ‘‘slow business and
big prices,’ and it is not difficult to de-
termine which system is best for the
masses, and it is for the masses that
the great problems of political economy
are to be solved

FRANK STOWELL.
En a

Suit Against a Collection Agency.

A New England concern which adver-
tises to collect ‘‘hard bills’’ for grocers
and others, and which is said to have
upwards of 150 subscribers in that
section, has a suit on its hands. The
plan of the collecting agency has been
to post the names of the debtors, their
addresses and amounts of the debts, on
trees, telephone and electric-light poles
in conspicuous places. The names are
printed on large white posters in large
black-faced type. A few weeks ago
one of the bills was posted on a pole in
a large New England city. One of the
alleged debtors thus advertised caused
the arrest of an agent of the collecting
agency a few days ago, the grounds of

his claim being that he was not owing
the bill at all.

Detroit
Tk I] RUBBER STAMP
e Company.

99 Griswoldsg treet.

 

 

SOS IES WEWw Ss sw SSI SS Fy SS SSeS F55
Ga POUCA eS SES ARSE EEEEISS

Monarch :

King of Bicycles

As near perfect as the finest equipped bicycle factory in the world
can produce—the acme of bicycle construction.

 

 

SARA

FOUR STYLES.
$80.

and

$100.

FOUR STYLES
$80.

and

$100.

SIN Sess "
ZSPN INIA EES

SACS
PONISI S)

San SeaISea= Sea sass

 

CeS3

If anything cheaper will suit you, the best of lower-priced wheels is Defiance;
eight styles for adults and children, $75, $60, $50, and 40, fully guaranteed. Send
for Monarch book.

Monarch Cycle Mig. Co.,

Lake, Halsted and Fulton Sts., = = CHICAGO.

BOIS OISI VICI}

GEO. HILSENDEGEN, Agent for Michigan, serra
ADAMS & HART, Agents, |

srand_ Rapids.

Ba SA SaSaixass

SARS AAS AAAS
EX

eS

S BOSONS Ser eSjSPNSSSSn
SSS A SS BS ES ADIAAISZARSS

 

 

o ° a o o ° 9 9 o oa ALS o o oO oO a a
° oO o o o o a a Q oO o ° °o o ° Se

<3 STIMPSON ey
eC

PERG

°o

o

o
IK

o

 

° °o
x ne
oO oO
oa So ei eee °
Woro - . ° o
oO °o
o °
9, oO ° oO
°o o
° °o
x oe
° rie fo)

Qo Theconstantly &¢

° Oo AS{o
a increasing de- &&

9 ° : t ° oO
o mand for the &

yore Stimpson Com- 20
a ° °

oye puting Scales ose
° _ ee °o
2 speaks louder

9 o olofy
° than words. :

9, o ° oO
° oO
°o °

° oO ° oO
o °
oO °o

9, o ° f.]
° o
a °

9 o TP . : “ ° lo
> lhe workmanship and material are unsurpassed, all bearings &@
© of tool steel or agate and all pivoted. |

2 aS It is a well-known fact that bank cashiers, in figuring discounts, Santo
° rely wholly upon their printed interest tables. Is not the average o

3erve grocer’s clerk, who in busy hours is trying to wait upon several °A°%o
© customers at once, as liable to error as a bank cashier? 2

9 °o ee °o 'o
° SKEELS & BUITENDORP. °
2 45 Fountain St. —

Ore Grand Rapids, Mich., Jan. 2nd, 1896. %{°
Stimpson Computing Scale Co., Tecumseh, Mich. S

Gentlemen :—
We find the scale perfect and are well satisfied with it. You can 5 a =

refer to us whenever you wish to. We claim that the scale will pay for itself
in three months.

9

Yours truly,
SKEELS & BUITENDORP.

C 2
° RE Neoeone oro oP oPMore(omeoPeoPeereore RISKS

a 9
° eas
oe °o
9
PEC
ow

°
°

x

 

 

 

panes

 

 

 

 

 

 

panera

THE MICHIGAN

 

TRADESMAN

8

 

 

Injudicious Buying and Dead Stock.

How to make the retail drug business
‘*pay’’ in these days of competition and
despite the encroachments by depart-
ment stores and others upon the trade
which has heretofore been regarded as
belonging exclusively to the druggist
that is the question. During the pres-
ent ‘‘hard times’’ it is an especially
pressing question. One thing is sure:
the buying is as important as the sell-
ing. Is it not a fact that greater care
in buying would afford considerable
relief in many instances where the
druggist suffers from severe competi-
tion, diminished sales, slow collections,
and heavy expenses? With a too mis-
cellaneous stock it is not easy to pre-
vent overstockimg the store. In fact,
whether the lines of goods handled be
promiscuous or not, every good mer-
chant knows that extra care and study
must be exercised to prevent unpro-
ductive investment of capital. In such
times as the present the retail druggist
might well make a careful study of his
sales and discover what goods are _ sal-
able and profitable, and what not.
Even if the whole trade of the store
consists of ‘‘drugs and medicines,’’ the
fact remains that many a_ druggist
makes the mistake of supposing that he
must carry in stock everything that
might possibly be called for or that is
official, and he carries too large a stock
of many articles. When it is remem-
bered that the kinds of articles handled
are so numerous, it is easy to see that
even a moderate reduction of the quan-
tities kept in stock will amount toa
good deal. In visiting our friends we
have often seen Jarge stock-bottles or
other receptacles for articles seldom
called for, and yet these receptacles
were pearly or quite filled for the sake
of appearances. We have heard drug-
gists say with pride that they had in
stock everything included in the Phar-
macopoeia, nearly everything mentioned
in the dispensatories, and many other
things besides. But it costs more
money to accumulate and keep up such
a stock than it is worth. Why should
any druggist have such obsolete stuff as
crab’s stones, dragon’s-blood, or even
cascarilla, ethereal oil, ox-gall, subsul-
phate of mercury, and a lot of plasters,
ointments, etc., that are seldom wanted
or do not keep well? Would not the
profits on thousands of dollars of sales
be saved annually if the druggist should
summon up the courage necessary to
refuse to keep on hand a lot of trash
which is no longer called for by intel-
ligent people? And is it not true that
many a druggist makes a quart ofa
tincture of which half a pint would
suffice for one year?

As a merchant the druggist should
not only abstain from handling mer-
chandise which does not yield a rea-
sonable profit, but he should try quite
as diligently to avoid carrying dead
stock and should study out the problem
of always having what his customers
will buy from him. Goods that may be
profitably handled in one locality may
not be found at all salable in another
locality only a mile or two a

ee
Salaries Based on Worth.

It is a delusion that men do not get
what they are worth. Now and then a
man is unfortunate, I grant, but, asa
rule, men get what they are worth.
Why, it’s the hardest thing in the world
to find a clean, strong, earnest, upright
young man—they’re as scarce as hen’s
teeth. I had a boy working for me
once at three dollars a week—I only got

 

two dollars and fifty cents when
gan —and the boy’s father, who is loom |
boss in a factory, came to me and _ said |
he guessed he’d take his boy out; he
could make more in the factory. ‘‘ How
much?’’ I asked. ‘Four dollars a
week.*’ ‘‘ Well, let him alone and he’ll
be getting five a week here after a
while. When the bov was getting eight
dollars the father came again, and
again I persuaded him to leave the boy
with me. When the boy was getting
ten dollars a week the father came
again and said he was going to take
the boy away. ‘‘What for?’’ ‘‘He
isn’t making enough money.’’ ‘‘What
will you do with him?’’ ‘*Put him’ in
the factory.’? ‘‘How much will he
get?’’ ‘*Twelve dollars first—-fifteen
afterward.’’ ‘‘Any more?’’ ‘‘Yes, he
may get to be loom boss.’’ ‘‘What will
he make then?’’ *‘ Seventy-five dollars
a month.” “"Well, then, let the boy
alone, he’ll be getting a hundred a
month here some day.’’ I had_ the
hardest work to get that man to leave
his boy, and we are paying the boy now
$200 a month.

It seems to me there is nothing for
it but education. I have tried profit-
sharing also. I tried profit-sharing in
my store; distributed $100,000. But
my people had no idea of thrift. One
woman took her $150 and bought a
piano, another bought a silk dress, and
so on, no idea of saving. I was dis-
couraged. Maybe I didn’t try the right
way, but it was not a success. I offered
to pay them interest if they would save
their money and put it into the store-
they thought I wanted to increase my
capital, and wouldn’t do it. I could
have borrowed plenty of money — for
less interest than I offered them. I do
not say I have given it up; a commit-
tee of the employes has the matter still
under consideration, but they report
that at present nothing can be done.
There is nothing for it but education.

You must educate the people up to
brother-love prices; if I should charge
brother-love prices now I would be in
the sheriff's hands in a few weeks. As
for men who deal unjustly with their
employes, | think you can make a pub-
lic sentiment that will make _ it too
warm for a man who is robbing labor.

No man ever made $150,000,000, or
even $50,000,000--he may have cap-
tured it in a sort of way, but he never
made it.

JOHN WANAMAKER.
> 02>

Attractive Hardware isis

Here is a brief description of how a
hardwareman has constructed and fitted
his store window: The window meas
ures 18 feet at the front and 12 feet in
the rear, and has a depth of 6 feet. The
two ends of the window are on an an-
gle, and are completely covered by sta-

tionary French plate mirrors 4 feet
high. ‘The effect of the mirrors is very

fine, as a reflection is given of the con-
tents of the window at either end. The
bottom and back of the window are
lined with garnet colored felt. There
are two columns in the window, which
are enveloped in sheet cork one-quarter
inch thick and covered with felt. These
are utilized for displaying pocket cut-
lery, scissors, etc., which are stuck to
the cork. No time or money is spared
in making the window attractive, and
the display is often changed. The win-
dow is completely closed at the side
and back by sash, preventing the dust
from the shop soiling the articles dis-
played. An electire arc light is sus-
pended in front of the center of the
window about ten feet from the foot-
path, thus making the display as effect-
ive at night as in the daytime.

|
Le

   
  
 

 
  
  

For a Bicycle that has more
points of merit about it than
any you ever saw and with a
style and finish that wonld
sell it alone, to say nothing
of the fact that it will pay
you to handle it, correspond
with us about

“THE GARLAND” §

PENINSULAR WHEEL 60,

13 Fountain St., Grand Rapids.

Also agents for eosin. er
ton, Phoenix, Ben Hu

Agents Wanted.

We have wheels from #40 to $100. Cor-
respondence invited,

Do You Sell Wheels?

Are you ‘‘in it’’ for Money?

ae so, you should handle good, reliable
wheels wheels with a good reputation.
When you sell a wheel you want to know
ithat it is sold, and that it will please
your customer. There is no nece oe for
buying an experiment. A good many
; wheels are made this year for the first
time and are therefore experimental.

*$90@O@eGee--

Here Is Our Line
Every wheel in it has an

| ESTABLISHED REPUTATION!

| | Helical Tube Premier
March
America
Monarch
Cycloid
Outing
Envoy and Fleetwing
Wolverine
Featherstones.

|
|
| Write us for Territory, Prices, etc.

ADAMS & HART,

Bieyeles and Sundries—Wholesale and Retail,

12 West Bridge St., Grand Rapids.

 

 

 

 

THE TALLY-

 

Made by the only exclusive Tandem [Manufactory in the World.

TANDEM TRUTHS.

1. An expectant publie is just beginning to realize the
pleasures that come from Tandem riding.
excessive strain on the front fork,
clumsy steering, and many other disagreeable features have
heretofore made Tandems inconvenient and undesirable.

3. The Tally-Ho, the result of careful experimenting, en-
ps overcomes all these objections.

The Tally-Ho is distinctly a Tandem, and, unlike many

a rs, is not constructed of bic ycle parts.

5. You should write for further particuiars.

2. Long wheel base,

THE TALLY- HO ) TANDE -M CO.
TOLEDO, 0.

 

 

 

 

 

4

THE MICHIGAN TRADESMAN

 

Around the State —

Movements of Merchants.

Chase—D.
market.

Auburn—Chas. Kern succeeds E. G.
Swart in general trade.

Horton—Geo. W. Landis, druggist,
has removed to Mason.

Adrian—The L. Ladd Co. succeeds
L. Ladd in the fruit canning business.

Cambridge --C. H. Dewey succeeds
C. H. Dewey & Son in general trade.

Fenwick—-fhompson & Curtis suc-
ceed Thompson Bros. in general trade.

Remus—A. L. Hawks _ succeeds
Hawks & Servis in the drug business.

lonia—R. G. Fuller & Co.’s jewelry
stock is in the possession of mortgagors.

Rosebush—Frank E. Reeves succeeds
Reeves & Carman in the hardware busi-
ness.

Caro--Watrous & Hankerson succeed
Frank O. Watrous in the hardware busi-
ness.

Saginaw—-Henry Melchers, druggist,
will be succeeded April 1 by Richard
Loew.

Kalamazoo—Fly & Morley have pur-
chased the grocery business of Hugh
Beggs.

Wacousta—Robt. G. Mason has _ pur-
chased the general stock of Frank C.
Brisbin.

Watersmeet— Krom
dealers, have dissolved, B.
ceeding.

Kalamazoo—Harry C. Koehler suc-
ceeds Koehler Bros. in the confectionery
business.

Lansing—Leonard & Leonard suc-
ceed Leonard & Everett in the grocery
business.

Holland—J. D. Helder is succeeded
by John Ver Schure in the boot and shoe
business.

Marquette—Manthei & Gibson, meat
dealers, have dissolved, A. Manthei
succeeding.

Hudson--Frank H. Brown, general
dealer at this place, will remove to Ft.
Smith, Ark.

Fenwick—F. L. Hammond _ has re-
tired from the furniture and undertak-
ing business.

Kalamazoo—S. J. Carson has _ pur-
chased the grocery and wood business
of E. A. Balch.

Sturgis—M. Esterson has purchased
the dry goods and carpet business of
Geo. G. Bender.

Petoskey—Cook & Ballantine, hard-
ware dealers, have dissolved, B. H.
Cook succeeding.

Nashville—Edwin R. White has pur-
chased the grocery business of F. A.
Stringham & Co.

Petoskey—R. C. Smith succeeds R.
C. Smith & Co. in the furniture and
crockery business.

Albion—Gunnison & Sanders, deal-
ers in groceries and books, have sold
out to A. E. Eddy.

Menominee—-Paul Kling & Co.,
druggists, have dissolved, Paul G.
Kling removing to New Munising.

Yale—Cavanaugh & Parkinson, gen-
eral dealers, have dissolved, W. A.
Cavanaugh continuing the business.

Hillsdale--C. E. Lawrence & Co.,
hardware dealers, have dissolved, C.
E. Lawrence continuing the business.

Muskegon—Frank H. Hartman, of
Oxford, has taken a_ position as phar-
macist in the West End drug store, and
A. W. Stevenson, who has recently
managed the store, has returned to his
old position in Fred Brundage’s main
store.

Hale has opened a meat

Bros., general
Krom suc-

 

Devil’s Lake—J. W. McGee & Co.,
general dealers, have dissolved. The
business will be continued by Arthur
Green.

Butternut—A. Conklin has moved his
store building from Bloomer Center to
this place and will soon have it stocked
with general merchandise.

Detroit—The W. H. Ellis Co. suc-
ceeds W. H. Ellis in the wholesale and
retail cigar and tobacco business and
has filed articles of incorporation.

Detroit—Chas. M. Roehm has been
admitted to partnership with Rechm &
Davison, hardware and wholesale car-
riage dealers, the style of the company
remaining the same.

Bay City—The Ueberoth-Ellis Co.,
wholesale and retail crockery and wall
paper dealers at this place and also at
Saginaw, will discontinue business at
the latter place May |.

Detroit—The Shaw Electric Rasp Co.
has been organized with a capital stock
of $10,000, which is held by the follow-
ing: Wm. Shaw, 650; Henry A. Par-
kin, 200; Bertram C. McRae, 150.

Evart—Mark B. Ardis has left the
employ of Jas. H. Thompson, and gone
to Lake City to enter into copartner-
ship with his uncle, Samuel Ardis, in
the general merchandise business at
that place.

Bay City--The dry goods stock of
McKeown & Daily has been turned over
to James R. Tanner, as trustee, and
will be closed out at once, the proceeds
to go toward defraying the indebtedness
of the firm.

Whitehall—Benjamin F. Reed died
last Thursday, aged 60 years. Deceased
was born in Sodus, N. Y., removing
to Michigan in 1857 and conducting a
farm and a general store in Oceana
county for fourteen years. In 1873 he
removed to this place, where, in company
with his sons, he conducted the grocery
business for several years.

Saginaw—Thomas A. Harvey,’of Mor-
ley Brothers, has been in Chicago for
the last week or ten days attending to
the details of establishing a branch
house in that city. Morley Brothers
have purchased the stock of the A. F.
Risser Company, consisting of harness
and saddlery goods and will be in busi-
ness at 76 Wabash avenue after March
25. Harness and horse goods for lum-
bermen will be made a specialty. Dan
Thompson, formerly manager of the
saddlery department of Morley Brothers
here will have charge of the Chicago
store.

Manufacturing Matters.

Bay City—C. C. Mengel, of Mengel
& Co., box manufacturers, is dead.

Three Rivers—Frank Case succeeds
Case & Coon in the lumber and coal
business.

Morgan —J. C. Munton succeeds J. C.
Munton & Co. in the saw and feed mill
business.

Reed City—W. W. Hatch has sold his
interest in the Reed City Roller Mills
to his partner, N. S. Martindale, and
will return to Grand Rapids to reside.

Ann Arbor—The Ann Arbor City
Chair Co. has been incorporated with a
paid in capital of $12,000, to embark in
the manufacture of patent reclining
chairs.

East Tawas—-The Holland-Emery
Lumber Co.’s plant will be able to get
an early start. The company has 30,-
000,000 feet of old and 20,000,000 feet
of new logs to cut the coming season.

Crystal—Mr. Potts, of Petoskey, has
purchased the Langdon land and _ tim-
ber, consisting of 2,200 acres, and has
commenced lumbering same, having

put in ‘three mills to cut the timber,
which will be hauled to Butternut tor
shipment.

Au Sable—Extensive repairs are be-
ing made on the H. M. Loud & Sons
Lumber Co.’s band mill. A battery of
six new boilers will be added, and
other repairs made. The mill will be
ready tostart early in April. The ‘‘lit-
tle mill’? owned by the same company
is undergoing repairs.

Cheboygan—The Whitehall Lumber
Co.’s mill, which has been idle for the
past two seasons, will be in operation
again the coming season. It has become
the property of T. J. Sheridan, of Grand
Rapids, who is President of the Michi-
gan Gold Mining Co., of Seine River,
Ont. Ed. Barry, who was connected
with the Whitehall Lumber Co., will
have charge of the business, and this
week puts a crew at work overhauling
the mill.

Detroit—At a meeting of the stock-
holders of the Pharmacists’ Cigar Co.,
the following directors were elected:
Oliver H. Grunow, of the firm of Gru-
now & Patterson; Fred J. Todd, of the
firm of Stevens & Todd; C. N. Ander-
son, D. S. Hallock, G. W. Stringer, A.
S Pasker, F. W. KR. Perry, F. F-
Nasmyth and W. E. Flynn. The di-
rectors then elected the folowing offi-
cers for the ensuing year: Oliver H.
Grunow, President; D. S. Hallock,
Vice-President, and C. N. Arderson,
Secretary and Treasurer.

Saginaw—Mills that have logs to saw
and the owners of which so desire will
doubtless be able to get an early start
this spring, although there is not much
incentive to mannufacture lumber at
present prices and conditions governing
trade. It is true there is considerable
improvement in the volume of business,
Lbut it still lacks the old-time vigor, and
the claim is that when the stumpage
price is calculated, together with the
cost of manufacture, there is very little
margin of profit for the bulk of the
stock. It is to be considered, however,
that the general trend of the times to-
ward a lower range of prices for all
manufactured products is accompanied
by reduced cost of production, and that
it will be a Jong time before a return to
the conditions that ruled a few years
ago will be experienced.

 

Marquette—The port of Marquette
will ship more ore this season than ever
before. This will be brought about by
the operation of the Lake Superior &
Ishpeming ore line, which is now build-
ing from Marquette to Ishpeming. The
road is being constructed by the Cleve-
land-Cliff and Pittsburg & Lake Ange-
line companies, unaided, and it will
handle practically the entire output of
these mines, as well as much additional
business. While these two companies
alone are building the Lake Superior
& Ishpeming road, a number of the
other mining companies of the Mar-
quette range are heartily in sympathy
with the movement and will give busi-
ness to the new line. The Cleveland
company built the first railroad from
Ishpeming to Marquette forty years ago,
selling the line later to the Marquette,
Houghton & Ontonagon Railway Co.,
the predecessor of the Duluth, South
Shore & Atlantic line. Heretofore
about half of the ore mined on the
Marquette range has been shipped via
Escanaba, on Lake Michigan, the
longer rail haul of sixty-six miles being
offset by the much shcerter water route to
either Cleveland or Chicago. The new
road will certainly injure the ore busi-

 

ness of the Chicago & Northwestern,

 

which has hauled over 4,000,000 gross
tons of ore to Escanaba in a single sea-
son, and it will reduce the figure of
shipments from the Lake Michigan
port.

>>
PRODUCE MARKET.

Apples—s2.75@ 3.50 per bbl. for good
quality Michigan and Ohio fruit. The
favorite varieties at present are Ben
Davis, Greenings, Baldwins and Roman
Beauty.

Beans—With a considerable increase
in receipts, the market is weaker all
around. Medium beans are the strongest
thing on the list, owing to scarcity.

Butter—Fancy roll is scarce at the
moment, easily commanding 16@17c.
Fair to choice dairy commands 13@14c.

Beets—25c per bu.

Cabbage —50@6oc per doz.

Celery—13c¢ per doz, bunches.

Cider—12'%c per gal.

Cranberries—-Jerseys in boxes are
still in limited demand and supply at
$2.50 per bu.

Eggs—The market is glutted, dealers
holding their stocks at toc, with no in-
dications of higher prices until Easter.

Hickory Nuts—(Ohio) Small, $1.25
per bu., large, $1 per bu.

Honey—Dealers ask 15@16c for white
clover, 13@14c for dark buckwheat.

Lettuce—12%c per lb.

Onions—Home grown are in fair de-
mand and ample supply, commanding
4o@soc per bu.

Pop Corn—Rice, 3c per Ib.

Poatotes—No change to note from
last week.

Seeds—Clover commands $4.75@5 for
Mammoth, $4.50@4.75 for medium,
$4.75 for Alsyke, $3.50 for Crimson and
$4.50@4.75 for Alfalfa. Timothy com-
mands $1.65 for prime and $1.85 for
choice.

Squash—%@Ic per lb. for Hubbard.

Sweet Potatoes—The market is high-
er, Illinois Jeiseys bringing $4.50 per
bbl. and $1.60 per bu.

__—__~> 2.
Flour and Feed.

We have experienced another week
of dull, dragging markets and a decline
of 1oc per barrel in flour, in sympathy
with the decline in wheat. Flour mills
throughout the winter wheat belt are,
as a rule, turning out but little more
than one-half their usual output, which
has, also, been the case for several
weeks, and, in consequence, stocks of
flour at country or interior points are
very small. At this season of the year
many small water power mills must,
necessarily, curtail their output because
of spring floods; and many of the mer-
chant mills cannot run steadily, on ac-
count of lack of wheat, until after a new
crop is harvested. These conditions
prevailing at the same time point to an
increased demand for good winter
wheat flours in the near future.

The prices of feed, meal and mill-
stuffs are steady and unchanged for the
week,

The city mills are running steadily,
making about the average weekly out-
put.

Wm. N. ROWE.

—_—_—» 0.

Excellent Meeting Place.

Although it has not yet been officially
decided upon, it is probable that the
next (fourteenth) annual meeting of the
Michigan State Pharmaceutical Asso-
ciation will be held at Mackinac Island.
While conventions have been held at
Detroit, Ann Arbor, Lansing, Saginaw,
Grand Rapids and Petoskey, no meet-
ing has ever been held north of the
Lower Peninsula, and it is confidently
expected that the selection of the
‘‘Fairy Isle’’ as the next place of
meeting will secure a large attendance

from the Upper Peninsula. The con-
vention will, probably, be held in
August.

o>

Smoke the Dodge Club Cigar.

 

 

 

 

 

aes

 

Rea ah

 

 

THE MICHIGAN TRADESMAN

5

 

 

Grand Rapids Gossip

 

Chas. M. House succeeds Burdick &
House in the grocery business at 588
South Division street.

G. B. Reitberg has opened a_ grocery
store at 17 Ohio srteet. The Ball-Barn-
hart-Putman Co. furnished the stock.

Wm. Barth, grocer at 1165 Wealthy
avenue, is succeeded by Fred C. Beard,
formerly engaged in the real estate
business.

H. M. Reynolds & Son have put
handsome quarter-sawed oak fixtures in
their office at the corner of Louis and
Campau streets.

L. F. Jones has embarked in the seed
business at 36 East Bridge street under
the style of the L. F. Jones Seed Co.
Mr. Jones hails from Gove City, Kan-
sas.

Miss Ida M. Spaulding, for the past
five years billing clerk for the I. M.
Clark Grocery Co., has taken the po-
sition of book-keeper and cashier for
G. R. Mayhew. The vacancy at the
Clark Co. has been filled by the engage-
ment of Miss Elda Stephenson, for-
merly connected with the office force
of the house.

H. V. Hughes and M. M. Hughes
have formed a copartnership under the
style of Hughes Bros. for the purpose
of taking the Michigan agency of the
National Cash Register Co., covering
the entire State with the exception of
the Southeastern portion, which is
worked from Detroit. The firm will
open an office here and make Grand
Rapids headquarters for the territory.

Another ruction has occurred at the
office of the Grand Rapids Seating Co.,
Jas. B. Furber having retired from the
position of Secretary and Treasurer at
the instance of President Frost. Mr.
Furber has been identified with the
business since its inception and had
come to be regarded as a fixture, owing
to his knowledge of the business, gained
during his connection with the Grand
Rapids School Furniture Co.

The Citizens’ Telephone Co. has
adopted the American telephone, man-
ufactured at Kokomo, Ind. Decisive
tests have shown this instrument to be
superior to any other telephone on the
market, not excepting the long-distance
Bell. With its double metallic circuit,
improved switch boards and superior
telephones, the Citizens’ Co. will be
able to give the public equally as good
service as the long-distance Bell—and
much better service than the Blake
transmitter Bell—at a saving to the sub-
scriber of from too to 200 per cent. By
the time the competing telephone sys-
tem is installed here, connections will be
made with a number of neighboring
systems, so subscribers to the Citizen
phones will have equally as advantageous
service as the Bell monopoly can_ offer.

a
The Grocery Market.

Sugar -All grades) were advanced
Saturday except Nos. 14 and 15, “all
the other grades except No. 9 (which
advanced 1I-16c) advancing 'c.

Oranges ~The market for Mediterran-
ean oranges has shown a_ stronger tone
this week, and as there are not many
coming, and the demand keeps strong,
prices have advanced from 25@soc.

California oranges are in good demand,
but prices are so high that actual sales
are moderate.

Lemons—The demand during the

 

period under review has shown consid-
erable improvement, and while values
are slightly firmer, there has been no
advance. The New York market is the
lowest of any of the receiving ports, as
the prices obtained at the sales in New
Orleans, Philadelphia and Boston show.

Spices—Prices generally are steady.
The market in this country on nearly
all varieties is lower than foreign mar-
kets, and at the prevailing values it is
impossible to cover import cost. The
stocks of pepper and cloves are quite
large here and European markets are
also overloaded with those goods. The
supply of nutmegs is ample. Cassia,
particularly Batavia, is in light stock,
while the holdings of mace and
pimento are small. There has been but
little done in cassia. Cloves have been
dull, the expected boom not materiali-
zing. In gingers, prices are slightly
easier on African, Cochin and Jamaica.

Canned Goods—The movement in
canned goods throughout the period un-
der review has been of small propor-
tions. There is, of course, some busi-
ness doing all the time, but individual
orders are light and confined to the ac-
tual wants of buyers. The trading is
devoid of speculative features, except
here and there where particularly low
values are offered, and then goods are
taken, but it is only occasionally that
values lower than qucted prices are
offered, as on nearly all canned articles
they are very low now, and nothing but
absolute necessity to realize can force
them much lower.

Provisions—There has been no_ espe-
cial activity to the provision market
through the week. As concerns specula-
tion the indifference to take hold has
been quite as marked as at any time in
the protracted period of dullness. The
hog receipts, which had been small, are
increasing, and are turning out more
than the average quantity of lard. The
trouble with the position is chiefly the
state of trade, which is remarkably dull.
The foreign markets pursue a very con-
servative course in buying in this coun-
try, notwithstanding their stocks are
probably this month showing some _ re-
duction.

Rice—The market for domestic rice
has been quiet during the entire week.
Notwithstanding the dullness, the situa-
tion is promising, as the present dull
condition is looked upon purely as tem-
porary, and conditions are likely to im-
prove as soon as present stocks of
cleaned goods are absorbed, and this
will be before long, as the principal
Southern mills are closed down and sup-
plies are not incresaing. It is said that
some of the mills have closed down for
the season, and, should this prove to be
the case, the benefit to the market gen-
erally will be very material, as it will
reduce competition and enable those
still in the field better to maintain and
regulate values. In foreign sorts, Japan
continues in most demand. The stock
of Japan in first hands is light, as is
also that of Java and Patna. There is,
however, only a limited demand _ for
those sorts, so that, whether stocks are
light or hee vy, it does not make material
difference. Japan rice is firm, owing to
light supply and concentration of stock,
it being said to be entirely in the con-
trol of one house.

TE
Good Value.

Merrimack shirting prints, new per-
cale styles at 44%4{c. Fast colors.

P. STEKETEE & SONS.

—_—__~<—9<—____

Gillies & Co.'s Standard
New York Spices are recommended
by food commissioners. J. P. Visner,
Agent.

Edwin J.

 

The Grain Market.

Wheat continued weak and declined
fully 3c during the week. It was a rep-
etition of the previous week. The ex-
ports were light, the receipts in the
Northwest were heavy and the weather
was favorable for the growing crop,
which was quite a bear factor and as-
sisted to depress prices. The Govern-
ment report shows the amount back in
farmers’ hands to be 123,000,000 bush-
els, against 75,000,000 bushels at this
time last year and 114,000,000 bushels
in 1894. This was another bear argu-
ment. Every one claims the Govern-
ment report is wrong as to the amount
in farmers’ hands. Where is it? Muich-
igan, Ohio and Indiana are virtually
bare of wheat. Texas, Missouri, Iowa
and Illinois have imported wheat.
Now, where are the 123,000,000 bushels
of wheat? As the Government makes
the report, it will stand. The fact is,
wheat has been hammered down so that
the trade has lost all faith in the mar-
ket and it requires a new lot of buyers
to put any animation in the market,
as all the sales were made _ to cover
short wheat. However, we may expect
a change, as the demand for flour has
been fair with the decline in wheat, and
this goes to show that the trade is not
overstocked with flour.

Coarse grain followed the drift of
wheat. Corn was weak and_ receded
4c. The receipts are large and the ex-
ports of this cereal have also been
large, but the fact is, there is a very
large amount of this grain yet to be
thrown on the market.

While oats are weak, they have about
held their own as regards price, and
they will, probably, remain at the pres-
ent low level.

The receipts in this market were:
wheat, 47 Cars; corn, 14 cars; oats, 8
cars; while Detroit received only 30
cars of wheat, 20 cars of corn and g
cars of oats. The mills are paying 65¢
for wheat.

C. G. A. Vorer.

—_____~>0.>____
The Dry Goods Market.

Prints, since being reduced to $c, find
a ready sale.

New wash goods also meet with better
demand. Some very good styles are
shown from 7!14@1t2!'4c per yard.

Dimities at 10%c are very beautiful
and in the larger retail stores are already
selling freely.

Plumitis Soir, a new fabric to retail
at 25c in Persian and striped effects, is
very fine and, no doubt, will meet a
large sale.

Percales at 7%; 81% and_ toc are
very good and large quantities have
been sold by local jobbers.

Brown and_ bleached sheetings are a
trifle lower. With raw cotton at 73¢c,
to-day’s prices on made-up goods are
certainly cheap, but just what the mar-
ket will be no one can tell for at least
two weeks.

Ginghams remain unchanged.

Uniform Size for Price Lists.

Grand Rapids, March 16—We are
now living in a time where uniform
goods and standard uniform prices are
demanded. Why is it not possible to
have a uniform standard size of price
lists? Traveling men, salesmen, brokers,
commission merchants, etc., are all out
selling goods and in nine cases out of
ten, the original manufacturers’ price
lists are sent or given tothe men. I
have to-day about twenty different price
lists with me, ranging from 1x4 to 8x14
inches in size, which is rather incon-
venient. Now, why wouldn't it bea

ood idea to advocate a uniform size
or price lists. Let each manufacturer

 

oz wholesaler confine his price lists to a
size of paper which can easily be placed
in a holder of some kind, so that the
sheets can be changed as often as re-
quired.

If you think this suggestion would
meet with the approval of the trade,
kindly advocate the same through your
valued paper and oblige.

L. WINTERNITZ,
Manager Michigan Spice Co,
~~ 2
After the Scalp of the Jobber.

In view of the fact that co-operative
manufacture and co-operative distribu-
tion have never been successful in this
country—for reasons which have al-
ready been discussed at some length in
these columns—the effort along that line
by the retail druggists of Detroit will
be watched with interest. In this con-
nection the Tradesman takes pleasure
in giving place to a communication
from the President of the Detroit organ-
ization, as follows:

Detroit, March 13—Our attention has
been called to a short but decisive no-
tice of the Pharmacists’ Cigar Co.,
headed ‘‘Doomed to Failure.’’ We
know that co-operative manufacture has
often been tried and has failed, for
many causes. The most important
ones the writer believes to be:

1. Lack of management, as_ those
who promote such enteprrises are, gen-
erally, from the ranks of workmen of no
business experience, and, while they
are good mechanics, they are poor busi-
ness men.

2. Wack of capital.

3. Want of a market for the product.

Many other points could be men-
tioned, but these are the main features.
In our intended departure we think we
have overcome these difficulties :

1. We shall employ a competent
business man to manage our affairs.

2, We are in a_ position to supply
all the capital needed.

3. We are our own customers.

Besides this, our business calls for
the sale of cigars, and we can definitely
calculate the profits from experience
and know what we can sell, so what
more is necessary for success?

The drug trade at this period of their
existence are forced to augment their
profits by every legitimate means. The
cutting of prices in medicines, the de-
moralization of trade generally, and the
advent of department stores all point to-
ward a closer relation with the retailer
and manufacturer. The province of
the jobber is every day becoming more
precarious. In this time of quick
transportation, his existence is not so
necessary as it has been and retail deal-
ers are beginning to realize this. How-
ever, this subject is inexhaustible. We
trust you will pardon this long letter
and extend to us the courtesy of a trade
journal, which should encourage, rather
than discourage, new enterprises.

C. N. ANDERSON,
Secretary and Treasurer.
Feminine Philosophy.

An observer watched a woman weigh-
ing herself in a grocery store the other
day. She had just purchased a pound
of saleratus and had it in her hand
when she stepped on the scales.
‘‘Why, I’ve gained a pound,”’ she re-
marked to herself when she had finished
manipulating the weights. Then, re-
membering her saleratus, she exclaimed :
‘*Oh, gracious! I forgot I had this, "
and hastily popped the package into
her pocket. Then she began to work
the weights and wondered why she
could get no different result. When
she left the store, with knitted brow,
she was still evidently trying to fathom
the mystery.

’

—~<>-@<—- — -

Endeavor Convention at
lonia.

For this occasion, the Detroit, Grand
Haven & Milwaukee Railway Co. will
sell excursion tickets to Ionia at one
fare for the round trip good going
April 1 and 2 and good returning until
April 4. Trains leave Grand Rapids
at 6:45 and 10:20 a. m. and 3:25 and
It p. mi.

Christian

Jas. CAMPBELL, City Agent.

 

THE MICHIGAN TRADESMAN

 

_ Hardware —

Practical Hints for Increasing Trade.
Tubal Cain in the Hardwareman.

In such an age as the present there is
no such thing as standing still in busi-
ness; either a trade is progressive or
the reverse. Many a tirm, after a pe-
riod of depression, may congratulate
themselves if they have transacted at
least the same volume of trade during
the bad year as during the previous
good one, even though they anticipated
doing more; and, certainly at a time
like the present, they who can boast of
having kept up their returns to the level
of former years may well and truly con-
gratulate themselves. If a_ firm exert
themselves to the utmost during the
slack year and succeed, only by dint
of hard work and close application, in
diminishing what would otherwise be a
serious loss, even though they barely
pay expenses, I should be inclined to
regard that firm as a progressive one,
and likely to prosper exceedingly in the
future; while another one who took
things easily, not seeking to go to any
trouble to keep themselves up to date,
or to adapt themselves to the times,
notwithstanding that they may have
cleared a profit in the same year that
their neighbors did not, I should be in-
clined to consider as likely to come to
grief.

Success in business is indicated not
merely by a large profit in one year
only, but rather by a more moderate
profit gradually and regularly increas-
ing with an increased turnover. But
the most capably managed business is
frequently stricken by the same de-
pression which is felt by their neigh-
bors, and all the skill and judgment
possible are needed in order to enable
its conductors to weather the storm. I
believe that in the weeding-out process
of competition which is so slowly but
surely taking place, especially in our
cities and large towns, such firms as I
have mentioned are more likely to. sur-
vive than others. More energy and
more thoroughness will be wanted in
another generation, and those of us who
think ourselves capable men in this age
will be deemed old-fashioned and slow
30 or 40 years hence.

Remembering all this, how necessary
is it that we all, as a trade generally,
should take a pride in fitting ourselves
for the altered position to which we are
drifting? How necessary is it that we
should banish all the traditions which,
for too long atime, have clung to the
trade, and endeavor to find our places
in the front ranks and march with the
times.

We have every facility in the shape
of trade journalism, which is an im-
portant factor in self-improvement. It
is within the memory of even the
youngest of us, when our trade litera-
ture was at a very low ebb indeed as
regards matter that would be of interest
to the dealer; now we have both quan-
tity and quality, and I will venture to
say there are few trades so well pro-
vided for.

If an honest and determined effort
to increase one’s busipess be attempt-
ed, many things must be borne in
mind, first and foremost among which
may be mentioned a well-bought stock
carefully selected and suited for the
locality, and as up to date as_ possible.
All old or unsalable goods should be
got rid of quickly by means of a clear-
ance sale or otherwise, for it is decid-
edly unwise to have one’s capital lock’ed
up in stock which is deteriorating year
by year. A good lookout should be
kept for novelties of a useful and_ sal-
able character ; these will make the shop
more more attractive, and they yield a
good profit in comparison with other
goods.

Then to help to sell the goods, it is
necessary that they be well displayed
both in the shop and show windows,
and also that the bulk of the stock be
kept in suitably designed fixtures and
shelves, so that customers’ wants may
be rapidly and carefully attended to.
Even the smallest details should be
planned out by the dealer who desires
his business to prosper, for nothing is

too insignificant if it helps to add to
the efficiency of the clerks or to the
comfort of the customers.

Advertising must be indulged in.
What form is best it is most difficult to
say, as circumstances differ so much ;
that which would succeed in one place
would fail in another.

In addition to those means I have al
ready mentioned, many a man of en-
terprising ideas will adopt means en-
tirely his own in pushing business. |
think most of the examples of this kind
have been recorded from that happy
hardware land—America. The man
who first conceived the idea of building
up a bicycle formed of grindstones and
tools in his window was such a one; so
also was he who gave away a very Con-
siderable number of gas stoves free on
a certain day, stipulating merely that
the recipient purchased a length of
India-rubber tubing from him.

Other means I can mention are the
intelligent annexation of other branches,
or, in other words, the gradual growth
of the original business, which may be
likened to a well-nourished tree planted
in generous soil, sending out new
branches during its existence, and ex-
tending its ramifications of roots in all
directions from the main trunk.

Too much stress cannot, in my opin
ion, be laid on any of the means I
have noticed if success is to be aimed
at. Indeed, it would be difficult for me
to point out any one of these means as
being of so much superior importance
as to require the larger amount of at-
tention. All are equally necessary, and
all must be intelligently made use of to
ensure a successful result.

The first consideration usually con-
cerns the stock. ‘‘A stock well bought
is half sold,’’ runs the hackneyed ex-
pression, but it would be more inter-
esting to know how to buy the stock
well. To do this the goods must be se-
lected to suit the wants of the district,
a suitable amount and variety of goods
should be bought, and they must be
bought at the lowest possible price.

BUY GOODS THAT WILL SELL.

The first necessitates a knowledge of
the local requirements such as might be
gained by actual service behind the
counter, or by the advice of a predeces-
sor in the store, or of a clerk who knew
the trade of the neighborhood very well.
I have, myself, erred many a time in
utilizing my past experience too literal-
ly when I accepted a new situation and
failed to adapt myself to the changed
circumstances. In one place I was in,
all our shelf hardware had to be_ priced
at such rates as to include screws for
fixing, which, indeed, seemed _reason-
able enough, particularly for private
customers; but in my next place the
very reverse was the rule, and at first I
persisted in pricing things in the same
manner, with the result that intending
purchasers who were educated to buy
their screws extra thought our prices
too dear. Any one who has ever looked
through an agricultural tool list cannot
have failed to observe the immense va-
riety of spades, shovels, hoes, forks and
similar articles required, and how each
agricultural district has its own shapes
and sizes, being too conservative to use
any others. It is surprising the amount
of dead stock which will accumulate in
the course of a twelvemonth, or the
amount of trade which will be lost in
the same period, unless the buyer be
particularly cautious. The same _re-
marks apply to the amount and_ variety
'of the stock necessary for the business,
and care should be exercised in gaug-
ing the quantities, especially of those
goods which are pushed as ‘‘leaders’’
and those which are generally bought
in large lots. It would be safer, at the
start, to purchase in small quantities
until the buyer gains knowledge. Some
|manufacturers advertise a specialty,
|say, an oil stove, at a certain figure for
|single ones, and offer to take a dis-
i count of 1o per cent. off for dozen lots,
| 15 per cent. off for lots of twenty-five,
| 20 per cent. off for lots of one hundred,
/and so on. It is manifest, from these
| terms, that the smaller dealer cannot com-
| pete with his big rival unless he buy in
ithe same quantities, and this may ap-

 

 

 

ply not merely to a single line of goods |

 

but to dozens of different fthings, as
many makers adopt this system in
pushing their goods. Thus it very often
results in the smaller man’s not stocking
such goods at all, or, if he does, his
profits are mighty near the vanishing
point if he sell at his neighbor’s prices.
What I would venture to advise is_ that
another manufacturer of similar goods
be sought who will deal more fairly
with the legitimate hardware dealer by
giving the same terms for 14-dozen lots
as for two-dozen lots, and only allowing
a small discount off the larger quanti-
ties, thus placing all retailers practical-
ly on an equal footing. Or, if 1 could
not discover another manufacturer, I
would buy, say, %-dozen at first, mark-
ing them at the same selling price as if
I had bought the largest quantity I think
I would buy if their sale was successful
with me. I would increase this amount
at a second order and by the time I was
able to order the third lot | could tell
almost with certainty whether or not I
should order the maximum quantity
then.

 

18 O00 ov

Our sap pails are full
size and are guaranteed
not to leak. They are
made almost straight,
flaring enough to pack
conveniently. Our syrup
cans are double seamed,
both top and bottom, with
packed screws.

Prices lower than ever.

Send for price list of
general line of tinware.

Wil. BRUMMELER & SONS,

Manufacturers and Jobbers of

Pieced and Stamped Tinware.

Dealers in Rags, Rubbers and Old Metal.
FPhone 640

eo. Gael lo.

   

 

°

Pex

 

 

Q ° 9 ° 9 9 ° o o 9 9 ° o ° 9 9° 9

RRR IRI IRS
° ° ° o ° ° ° ° ° ° ° ° ° ° a o

° o

°, : ° 9 3
) °
x x
: S
° oO ° ‘o
: 3
ooro oASo
° °
x x
: :
Boro ° o
° °
9. - °o ° . oO
° °
°o °o
9 Cc ° °
: :
° ° ° o
: :
°o o
9, oO ° . f}
° °
° °
ne Ne
e e
oo 0 N0%,
° °
° °
x x
° °
9 ° ° S {)
S S
9 ° ° ‘o
S
a a
S 3
9 ° ° o
: $
9, ° oO j0%,
: :
x Ne
: :
x ne
: e
9 ° ° oO
a e
9 ° ° ©
: e
9; ° ° ‘o
S S
9 o ° oO
S S
9 ° ° oO
° : . °
See Both the best of their kind. NP
32 Get in your orders at once. =
9 o ° So
2 ———— 3
9 ° ° 0
° ‘ =
9 fe) ° oO
° °

KP GRAND RAPIDS.

aK

°

oO oO o Oo ° ° 9 9° o ° Xe J ° ° o °
SOCORRO

°o ° °o ° °o o ° °o °o °o owoo ° ° o °o

°
o8sofo
°o

o

°
°

 

i me meme mea i

 

 

 

 

i ee

eas TaN NRE

 

Cn Re aE ee

eee

Sana

 

ao a ore

a

- day,

THE

 

MICHIGAN TRADESMAN

 

 

SUCCESSFUL EXAMPLES.

Although I have given praise to our
comrades across the herring-pond, |
must at the same time conscientiously
give the greatest credit to the conduc-
tors of several ironmongery establish-
ments at home, who have shown by
their example a forwardness and an en-
terprise far in advance of their neigh-
bors. That they have benefited by such
go-aheadness proves that the public ap-
preciate those methods. Why should
such men have so few imitators? At
the height of the gold- -mining fever,
when stories of rapidly acquired wealth
were quoted in the newspapers of the
thousands of people, allured by
these wonderful accounts, which, by
the by, were not always trustworthy,
threw up their callings and flocked to
the mines, too often, alas! to meet with
only the most disappointing results to
themselves; but in less exciting times,
when we read in this or any journal the
account of a successful business man,
who very unselfishly tells the means he
made use of and the system he em-
ployed in building up his trade, we are,
most of us, inclined to content our-
selves with regarding him as being sur-
rounded by every favorable circum-
stance; in other words, we say he_ has
been lucky. I wonder how many there
are who become infected with a similar
energy when they read of an energetic
career?

I am much inclined to think that all
around we are not as enterprising a
trade as we might be, but there has been
much hopeful improvement during re-
cent years; and if the progress toward
perfection ‘has been slow, it is all the
more sure and enduring ; results which
have been achieved too quickly are
often lacking in stability. Let this not
be construed into an unconditional ap-
proval of a slow-and-sure policy at all
times; we must, all of us, be on the
alert as much as possible, and endeavor
to mend in the future those which we
now know to have been faults either of
omission or of commission in the past.
if slowness of progress is as essential in
the foundation of a business system as
in that of a building, there surely is
less need of it in the more advanced
stages of either, and we can therefore
now bestir ourselves and ‘‘hustle’’ a
little.

ADVERTISING.

Advertising, when done with care
and judgment, is truly a great power
in building up business. It appears
under so many different phases s, and is
so universally employed in one form or
another, that it is the most widespread
of all the means employed for increas-
ing one’s trade. Indeed, it is frequent-
ly difficult to say what is not of the na-
ture of an advertisement; the man who
paints his name over his doorway ad-
vertises, so does he who puts price
tickets and goods into his windows. It
is only a question of degree between
these men and those who insert a col-
umn of matter in the daily paper, or
distribute bills and cicrulars by the
thousands.

—___»~e .>___—
Dressing Store Windows.

The retail hardware store is the best
place for a beginner to learn the details
of the business. It is like a boy ina
small machine shop, where he has to do
a great variety of work, and thereby ob-
tains a broader knowledge of the trade
than would be possible in a large estab-
lishment where he would do the same
work over and over, day after day.
Again, in the retail store the constant
contact with the men who use the goods
sold affords an insight into their relative
values and adaptation for the purposes
required, and if the salesman keeps his
ears and eyes open and asks questions
freely he will soon acquire a fund of
useful, practical information of vital
importance in his future progress. The
reading of trade journals is a great help
in keeping the mind active, as the
brain, like the knife, retains its keen

edge only by frequent rubbing on the

 

grindstone of other people’s  experi-
ences. In regard to the dressing of
show windows, I think particular etten-
tion should be given to making a good
display in the upper front of the win-
dow. Some dealers prefer to have the
windows left clear, so as to permit of a
good view of the interior of the store,
which has some advantage, but as a
general_rule the more display made in
the window the better. Imagination
goes a long way with the majority of
people, and if the window is attractive
they will step inside the door to view
the interior, which they might not do if
the window afforded no view

Glazed paper of suitable color is quite
effective for the floor of the window,
and makes a bright and easily changed
surface for displaying goods. Saws or
any other bright surface goods which
are light in weight may be hung ina
show window, and a good display is
the use of brass covered curtain
poles, of, say one inch diameter. Cut
them up into lengths of proper size to
fit the windows, screwing on the cut end
a brass curtain knob, of which many
handsome designs are now on the mar-
ket, at a cost of a few cents each. The
saws are then hung by the handles on
these rods, and produce a good effect.
Brass jack-chains can be _ festooned
from one rod to the vther, from which
other tools can be neatly suspended.
This arrangement occupies the upper
part of the window, and does away with
the cold ‘‘gallery effect’’ which is
often seen in store windows.

The floor of the window, having been
covered with the glazed paper, is used
to display smaller articles which re-
quire a close view to be appreciated. A
neat show card hung by a fine hair-
wire, to face the sidewalk, can be used
to good purpose. Frequent change is
absolutely necessary to keep up public
interest, and dirt, dust and dead flies
must be conspicuous by their absence.
The brass rods mentioned can be_ pur-
chased for an amount not to exceed
three dollars, and can be used for years
as permanent window fixtures. The
rods are made of wood and covered
with a thin sheet of ‘brass, which com-
bines lightness with showy effect. If
time permitted I would be glad to de-
scribe some other details in the matter
ot the displaying of goods, but will be
obliged to defer them for the present.

M. RICE.

>7e2
The Hardware Market.
General Trade—Remains stationary,

as per our report of last week. There
is more enquiry for spring goods, but
the general talk with the retail dealer is
that he will wait until the consumer
commences to show evidence of return-
ing life and begins to want something
and has the wherewithal to pay for it;
then he will begin to buy again. That
is about the general situation, so far as
selling goods is concerned. With the
factories, the report is that there 1s only
a fair demand for their products among
the jobbers, as they, also, are pursuing
a waiting policy as long as they can.
They, however, are obliged to take more
chances and are getting in their Spring
goods, such as wire cloth, poultry net-
ting, barbed wire, steel. goods, screen
windows and doors, etc. As to any
change in prices there is but little.
Goods in most lines have reached the
low figures prevailing a year ago and,
while there may be some advances, it
is not to be expected that we will have
two ‘‘boom’’ years in succession.

Wire Nails—Are firm at the last ad-
vance. There are rumors that another

 

advance of toc a keg will be made ir |
April, but it is to be hoped that wiser
council will prevail and prices remain
where they are.

Barbed Wire--The demand keeps up
well and prices remain low. An ad-
vance at any time may come. We do
not think the dealer takes any chances
in buying at present prices.

Window Glass-—
as yet. Factories are again all running
and claim that the recent shut down |
will produce a shortage in the supply
more than they can catch up with be- |
fore June 1, when they again all close
down for the summer.

Strap Hinges-—Will
cent. April 1.

advance Io per

 

 

Hardware Price Current.

AUGURS AND BITS

 

Snell’s.. os ae 70
Jennings’, genuine.. el ee
Jennings’, 2 60K10
AXES
First Quality. S. B. Bromze................. 5 50
First Quality, D. B. Bronze................- 9 50
First Quality. S. B. S. Steel.. te Oe
First Quality. I. B Steer. .................. 10 25
BARROWS
Ratireg@ 0)... $12 00 14 00
C—O net 30 00
BOLTS
Menge... ae eee ace ae =
— new Mae
ee oe 40810
BUCKETS
Wel pain $33
BUTTS, CAST
Cast Loose Pin, figured. . SS tee
Wrought Narrow ee 610
BLOCKS
Ordinary Tackle.... ....... beeee Gece 70
CROW BARS
Cast Steer. ..-...- per Ib 4
CAPS
Byis tie perm 65
Wiewis@. fo os. --perm 50
CP. per m 35
Maske... eee perm 60
CARTRIDGES
Rim Mire: -.-..- oot «ee
Gentrat Hire. .......-. .-.. -..... 2G 5
CHISELS
Moeet Mimer. 8 sO
ros tit... lo xO
Soeeet Comer... sO
Seekee Silens ........._....-... -. 80
DRILLS
Morse’s Bit Stocks ..... oe . 60
Taper and Straight Shank. oo HK 5
Morse’s Taper Shank.......... ys eeu 5
ELBOWS
Com. 4 piece, Gin...... ......-.---- doz. net 60
Comuciied aie oe
Adjustable...............--............. dis 40&10
EXPANSIVE BITS
Clark's small, $18; lenge: 2. ........ | ae
Eves’, 1, $18; 2, #24; 3, O.................... pa)
FILES—New List
ht... LC FOK10
Mich enGHEe. (0.0... - ee 70
Hollers Horse Rasps........-...--...-...- -60&10
GALVANIZED —
Nos. 16 to 2); 22 and 24; 25 and 26; 27. ... .
List 2 13 14 15 16 eee 17
Discount, 70—10
GAUGES
Stanley Rule and Level Co.’s.......-.....-- 60&16
KNOBS—New List
Door, mineral, jap. trimmings ee 7
Door, porcelain, jap. trimmings............ 80
MATTOCKS
Adve Bye... $16 00, dis 60410
Hunt Eye.. ee Geese 15 00, dis 60&10
Hanes... 6... " $18 50, dis 20&10
MILLS
Coffee, Parkers Co.’s. 40
Coffee, P. S. & W. M fg. C 0.8 | Malleables. 40
Coffee, Landers, Ferry & Clark’s...... : 40
Coffee, Enterprise..........-... -+-------- : 30
MOLASSES GATES
Stebbin’s Pattemi............-.. . .--....... 60&10
Siebbin’s Genmine ..........-.-.........-... 60&10
Enterprise, self-measuring ...-.-.—------
NAILS

Advance over base, on both Steel and Wire.

Stoel naiia, bAaSE......... ......-..----...--. 2 65
Wire nate’ bese... - ......-.............. 2 70
10 to GO advamee........... 2-2. 25-0 5e ees .
Pange@ ee oe on v6)
4c Ls... 90
ee eee ee eee cs 1 20
eases a 1 60
aca ............ Ct. 1 60
Cite M8 6
ee vi
Case @...........«- ee a 90

|
|
|
i
|
|

 

No change to report |

:
|
|
|

 

  

Wines 16... a 7D
Pinte S............-..--. 21... 5. a 90
[Wome ©... ee 10
en 6... 7
Cie £. ..... 80
i ce ee 90
an +. ese 1d
PLANES
Onie Tool Co.'s, faiiey...................... G@ae
ee ..60&10
Sandusky Tool Co’s, faucy...........--++-- @50
Beneh ticsiguality.................5..5...-. @50
Stanley Rule and Level Co.'s wood.. ' 60
—

Fry, Acme sli a .. 6C0& 10410
Common, polished... We 5
RIVETS
bron and Tinned .... ..-....-. .--. «.-.... 60
Copper Rivets and Burs. 0410

PATENT PLANISHED IRON
“A Wood's patent planished, Nos. 24 to « xa 10 20
‘B” Wood's patent planished, Nos. 25 to 27 9 20
Broken packages 4c per pound extra.
——
Maydole & Co.’s, new list........-. -—_— 3345
Kip’s is 25
Yerkes & Plumb’s. a “dis 4010
Mason's Solid Cast ‘Steel... |... B0€ list 70
} Blacksmith’s Solid Cast Steel Hand 30c list 50410
HOUSE pummel GOODS
Stamped Tin Ware. -new list =
Japanned Tin W GS 20.410
Granite Iron Ware. -new list 40&10

HOLLOW WARE,

Pots. . . nes. «ss Oe
ee ee ety 60&10
Speeers  .... ...:.. 1... ets. .. 60&10
HINGES
Gate Clarks, 1.27,3.....--........-.._.- dis 60&10
Ts ae a per doz. net 25
WIRE GOODS
Bigg ete 80
Screw Wyes........... --..-..........-...... 80
WiGGme 80
Gate Hooks and Eyes. . ie deed aces. 80
LEVELS
Stanley Rule and Level Co.’s............dis 70
ROPES
Sisal, % inch and larger..........-.... -..- 6%
Mania... .............-...,.... ee 9%
SQUARES
Gicel aad ison. ..........--..-............_.. 80
Try and Bevyels.... .....---.-...-----sesseee
ac...
SHEET IRON

com. smooth. com.
Nos. 10ta (4.__............_...... aa oe #2 40
Woe is tei. ol. Ll ll Bae 2 40
De ee . 3 2 60
Noe 2 to St... 3 55 270
Oe eee 3 70 2 80
oe ae 3 8 a

Ww jae a not si ‘than 2-10 extra.

SAND PAPER
Bist aeet 10 S6...............-.......... dis 50
SASH WEIGHTS
Solid My@s....0 1. per ton 20 00
TRAPS

Steet Game. ...../......_._........ 60&10
Oneida Community, Newhouse’s

8 50
Oneida Community, Hawley & Norton's or

  

Mouse, cheber...........-....-. per doz
Mouse, delusion...........-...-. per doz t 2
: WIRE
Bright Market...........5.........-.... .... vb}
Aimealed Mareet........................... 75
Coppered Market.................--.--.--.--T&10
"imscd Mewmct. .......-_....-............. 524%
Coppered Spring Steel........-- .-.+++++++- 50
Barbed Fence, galvanized ........ .......- 2
Barbed Fence, painted... : .. 1 90
HORSE NAILS”
AuSable... dis —_
CE dis
Nowmiwestems..|....................._... dis 10810
WRENCHES
Baxter’s Adjustable, mienmeleg@.....,........ 30
Coes Gomuine....... .......-... -.-. a. 50
Coe’s Patent Agricultural, ——e Nea cues 80
Coe’s Patent, malleable. . . reese 80
MISCELLANEOUS
Bird Cages .......---- ee 5
Pumps, Cistern............ ------------- 7&10
Serews, New List.. ec a 85
Casters, Bed and ee - 50&10&10
Dampers, American..... cue. 40410
METALS—Zine
600 pound casks. . Le 6%
Por gound...................-. 6%
SOLDER»
BEG nn ee ee eter tenes ons

1244
The prices of the many other qualities of solder
in the market indicated by private brands vary
according to composition.
oe ee

10x14 IC, Charcoal.. eoeceeee Oo oe
$4220 1C, Charcoal ..... .......-.-.......... 5 2
20x14 Ix, Coaeea 6 25
14020 1%, Chareoal........ .....-............ 6 25
Each additional X on this grade, $1.75.
TIN—Allaway Grade
16x141C Charcoal ............... .......... 5 00
14ee0 0 Charcoal ...... -.... ....-.-...... 5 00
10014 IX, Charcoal .................-.-...... 6 00
1402005 Charecoa!.... -.. ..-...........-.. 00

Each additional X ‘on this grade, $1.50.

ROOFING PLATES
14x20 IC, Charcoa!, Dean....... ese eas
14x20 IX, Charcoal, Dean......... «.....-...
20x28 IC, Charcoal, Dean........ ....-....-
14x20 IC, Charcoal, All» way Grade.........
14x20 IX, Charcoal, Allaway Gradc.........
20x28 1C, Charcoal, Allaway Grade........
20x28 IX, Charcoal, Allaway Grade......... 1
BOILER SIZE TIN PLATE
14x56 IX, for No. 8 Boilers,

SounsSan
SSSessE

 

 

14x56 IX, for No. 9 Boilers, { per-pound... 9
* Detroit

Rubber Stamp

e Company

SS Griewold St.

 

THE MICHIGAN TRADESMAN

 

 
   

MICHIGAN TRADESMAN

Devoted to the Best Interests of Business Men

Published at the New Blodgett Building,
Grand Rapids, by the
TRADESMAN COMPANY
ONE DOLLAR A YEAR, Payable in Advance.

~ ADVERTISING RATES ON APPLICATION.

 

Communications invited from practical business
men. Correspondents must give their full
names and addresses, not necessarily for pub-
lication, but as a guarantee of good faith.

Subseribers may have the mailing address of
their papers changed as often as desired.

No paper discontinued, except at the option of
the proprietor, until all arrearages are paid.

Sample copies sent free to any address.
Entered at the Grand Rapids Post Office as

Second Class mail matter.

When writing to any of our Advertisers, please
say that you saw the advertisement in the
Michigan Tradesman.

‘E. A. STOWE, Epiror.
WEDNESDAY, - = - MARCH 18, 1896.

GROWING POWER OF MONEY,

The greatest foe to the welfare of the
United States and the people of this
great republic is the growing power of
wealth. In a democratic country, the
object and tendency of its institutions
are not to keep the people down to the
same dead level of equality of condi-
tions, but to give them an equality of
rights and confer on each an opportu-
nity to reach the highest position to
which his labor and his talents and
character can lift him.

It is, therefore, the mission of demo-
cratic institutions to raise the people,
not to keep them down, or rather to
aid them in themselves, and
this is seen in the fact that the highest
public places in the country are open
to any citizen. The object of demo-
cratic institutions is to encourage and
open the way for the highest possible
development of the people.

Some persons, mistaking the meaning
of democratic institutions, seem to
think that the business of government
is to prevent individual development,
and to keep all the people down to the
lowest level, or to raise all alike to the
highest. Either course is wholly im-
practicable, intellect, enter-
prise, energy and thrift would rebel at
the idea of being kept back with the
dunce, the drone, the loafer and the
beggar, while that large class which is
resolved to live on the earnings of
others cannot by any process of legisla-
tion be made into honest, virtuous and
worthy members of society.

The only thing that a wise political
and social system can do is to give to
each member of society an opportunity
to attain and accomplish the best re-
sults of which he is capable, and after
that he must be held responsible for his
failure or success. The result of such
a system has been to stimulate every
worthy human talent and to bring about
a high state of development in every de-
partment of life.

For a long time the tendency of this
democratic system was to create a_ sort
of aristocracy of intellect. Persons de-
voted to the learned professions, authors,
artists, and those who had
attained eminence through their intel-
lectual distinction, constituted a sort of
higher social class, and there was a
sound basis.for a mutual respect and
recognition of all its members.

But such a circle was _ necessarily
closed to all who could not claim in-
tellectual distinction. Above all, it

 

raising

because

inventors

was organized without regard to material

 

riches. There were in it rich people
and those of moderate means, all asso-
ciating on a basis of intellectual and
moral equality ; but many persons who,
in the money-grabbing age which fol-
lowed the civil war, had become very
wealthy, and who were seeking for so-
cial prominence, were unable to enter
it. Then arose a movement to create
a sucial aristocracy based on money.

Immediately after the close of the
civil war, when the first income tax was
in operation, there were not in the en-
tire Union more than twenty persons
who were charged with an income of
$1co,o0oo a year. To-day there are in
the country more than 4,000 persons who
are millionaires. Many of them live
in the city of New York, and there
they have established a social class
with which the press, not only of that
city but of the entire country, greatly
concerns itself.

But if wealth were only a mere social
force, it would be innocent enough,
Nothing can be more fitting than for
persons with the same sort of tastes and
ideas to form associations for pleasure
or improvement. The great trouble is
that wealth is coming to be the greatest
political force in the country. Jt has
come to be notorious that the Federal
Congress is infested by powerful lob-
bies working for legislation in the in-
terest of commercial monopolies and
all sorts of money-grabbing schemes.
Not even State Legislatures are free
from these pernicious influences, while
municipal councils are constantly as-
sailed by bribers and corruptionists
seeking contracts, franchises and other
legislation. Even the Federal courts
have not been exempt from scandalous
imputations.

It is not surprising that repeated and
continued assaults upon public official
honesty should have resulted in  bring-
ing it to a low standard, and this has
had its effect on private sense of honor.
Men who do not hesitate to pay bribes
to public officials will finally become
less exacting in private affairs; and, as
the power, public and private, of money
increases, the desire to accumulate it
will increase also. If money be the
greatest political and social power in
the country—greater than intellect,
greater than the ballot—then there will
be a mad rush for money to be got, no
matter how, so only that it be got.

Who can blame people from becoming
demoralized under such circumstances?
And it is this mad rush for wealth
which is creating a socialistic sentiment
throughout the country. People who
never expect to accumulate wealth, and
who in many cases would never make
the attempt, are seeking some way by
which the rich may be deprived of what
they have and their wealth be dealt
around to those who have nothing. This
has always been the dream of the
drones, who contribute nothing to the
common stock, and who want to live at
the expense of others; but it is taking
hold upon the laboring classes, who see
no hope of rescue from the great com-
mercial and labor monopolies which
seem to be above the laws and beyond
the power of the courts. This is some-
thing for the statesmen, if there are
any in Congress, to think about.

 

ORANGES AND FROST.

It is claimed that the orange tree
thrives best in a climate of sufficient
cold to endanger the fruit by frosts, or
even to endanger the trees themselves,
as in the great Florida frosts of Decem-
ber 29, 1894, and of January 8 and 9,

 

1895. While the California fruit is
never in danger of so severe a frost as
these, they are frequently sufficient to
destroy quite a percentage of the fruit.
The Riverside district lost $750,000 in
value in a single frost in 1891, and
again last winter there was a frost in
the same district, producing ice five-
sixteenths of an inch thick, some of
which lay unmelted for two days. The
loss to the crop by the latter is various-
ly estimated at from Io to 50 per cent. ,
but, even with this loss, it is estimated
that the shipments will exceed those of
last year. A serious feature of the
matter is that there is suspicion of all
the fruit from the locality on account
of it.

Probably the most serious loss ever
sustained in this crop was the one re-
ferred to last season in Florida. The
value of her orange groves was estima-
ted at $35,000,000. Not only were all
these practically destroyed for the time
being, but the frost was equally fatal
to the lemon, grape fruit, fig, cocoanut
and similar trees and to thousands of
acres of vegetables. It was estimated
that the yield of oranges for that season
would be 5,000,000 boxes. It will be
seen how thorough was the destruction
when it is stated that the present crop
will not exceed 60,000 boxes. These
are netting growers $2 to $2.50 on the
trees.

It seems that these catastrophies in
both California and Florida are to be
anticipated. In the former, mild frosts
are quite common—the Rocky Moun-
tains are a safeguard against severe
ones—while in the latter the occurrence
is less frequent, but more severe. In
1886, there was a discouraging freeze
and in 1835 the mercury registered
seven degrees above zero at Saint
Augustine, and the Saint John’s River
was covered with ice. All orange trees
were killed.

After the freeze of last season many
gave up the business in despair, or
were ruined financially so they had to
give it up; but many immediately set
to work budding afresh, sending to Cal-
ifornia and elsewhere for buds. There
was a frost at Jacksonville, during the
cold wave in January, sufficient to in-
jure tender shoots, the mercury register-
ing 28 degrees.

 

INJURING THE CITY’S CREDIT.

There is serious criticism
business men over the action of the
‘‘irresponsible majority ’’ in the Com-
mon Council of Grand Rapids for their
persistence in insisting on issuing
bonds for the municipal ownership of
an electric lighting plant, in spite of
the serious questions of legality which
have manifested themselves since the
matter was submitted to the voters two

among

’

years ago. This persistence is to be
deprecated, for the reason that these

questions will affect the market value
of the bonds, and, if asale is ultimately
effected, the proceeds will be less than
if there was no taint on their regularity.

The question is naturally suggested as
to the reason for not remedying these
defects before making the sale. The
answer is to be found in the fact that
the promoters of the scheme dare not
submit it again to the voters, knowing
that a full discussion, calling out a
sufficient vote to place its legality as to
the majority’s voting for it beyond ques-
tion, would ensure its defeat. There
would, probably, be no trouble in get-
ting the Legislature to remedy the ac-
cidental omission, which gives it the
other most serious element of doubt, but

 

this would involve a rehearing before
the people.

The tendency to rush recklessly into
debt is the most serious menace which
threatens this city. This is a tendency
on the part of promoters and schemers
whose operations have not received
enough consideration at the hands of
the people. The present anxiety as to
ways and means to meet the city bonds
which are to mature in a few weeks,
and the contriving and scheming to bor-
row from other funds to the extent of
legal possibility, will cause an awaken-
ing to the seriousness of reckless drafts
on the future which will, it is to be
hoped, insure more careful considera-
tion of such matters.

 

TRADE BADLY MIXED.

Trade is still seriously affected by
the lack cf anticipated consumption
and the operation of combinations. Iron
stocks have continued to increase, oper-
ating in a further decline in prices at
Pittsburg to secure sales. Finished
products are held up in hopes of in-
creased demand, which does not come.
Demand is favorable in the minor
metals.

The demand for wool has been very
small but the price is maintained. Cot-
ton has scored a slight advance. But
the condition of both manufactures is
very unsatisfactory. A considerable
stoppage of works has not been suffi-
cient to prevent the accumulation cf
stocks. Avery demoralizing element is
the prevalence of undervaluations in
imports.

The wheat boom has met with a de-
cided setback, prices having lost about
one-half of the entire advance of 12
cents per bushel. It is difficult to ac-
count for the decline except upon the
theory of speculative reaction, although
crop reports and foreign advices have
been bearish in tendency.

The most favorable industrial indi-
cation is found in the railway earnings
for February, which were 14 per cent.
more than for the corresponding month
last year, the heaviest increase being
in the grain carrying lines, the least in
the coal roads. Business failures for
the week show a slight increase over
last, being 282 against 271 for preced-
ing week. Bank clearings, 11 per cent.
smaller than for preceding week.

In the financial centers money is_re-
ported easy, and there is an improve-
ment in industrial stocks, owing toa
decided decline in speculative activity.
Money is seeking investment in perma-
nent securities and these have had a
decided advance, some of them having
attained abnormally high prices.

The question of road improvement
seems likely to soon have a hearing in
Congress, a bill having been considered
in the House Committee on Agriculture
to create a special commission on high-
ways, whose purpose is to inquire gener-
ally how the Government may further
promote the improvement of highways,
and the best methods of securing a scien-
tific location of highways on the public
domain, and for the employment
of the Geological Survey in the discov-
ery of road materials and the free _test-
ing of these, and the construction of
modern roads and instruction in road-
making at agricultural colleges and ex-
periment stations. So far the expres-
sions of opinion received by the com-
mittee have been strongly in favor of
the bili, which, its advocates say, con-
templates no great expense and no in-
crease of salaries, and the life of the
commission proposed by which is
limited in time.

 

 

—m

 

eS

 

 

 

=}

 

 

 

 

THE MICHIGAN TRADESMAN 9

 

MENTAL HEALING.

This is essentially an age of inquiry,
and the natural and obvious result of it
has been a vast amount of investigation
and much important discovery in many
departments of science.

The amount of success in discovery
has stimulated research and inquiry in
many directions, which will, in all
probability, produce important fruits of
knowledge.

Just now a subject which is growing
into much prominence is the question
of the mental healing of bodily diseases,
and this is further complicated with the
theories of spiritual healing. There
have been many claims by individuals
to such healing power and much testi-
mony in their favor; but the diseases
supposed to have been cured have been
usually of a nature so obscure that the
facts could be known only toa very
few, and were not assured to the masses
of the people.

The healing performed by Christ and
his apostles was ®generally of a nature
which would be recognized by the
masses of the people, such as the resto-
ration of sight to the blind, or vitality
to withered and paralyzed limbs, and
the cleansing of lepers. When indi-
viduals notorious throughout a commu-
nity for their helplessness and hopeless
conditions of disease were suddenly
made whole and strong, there was
something which even the plainest peo-
ple could understand ; but when disor-
ders whose conditions and symptoms
are known only to the sufferers them-
selves ‘are cured, the fact cannot be
made so manifest to the public.

It is upon this general fact that skep-
ticism as to the curative power of mind
and spirit over matter is chiefly based.
Nevertheless, the power of the mind
over the body is not only a reality, but
a very decisive one. Almost everybody
knows how anxiety and worry are capa-
ble of destroying all desire to eat and
power to sleep, and, operating long
enough, they are able to disorder the
bodily functions and break down the
health. It is known, on the other hand,
that under the influence of hope, or sus-
tained by a strong sense of duty, or
spurred by ambition, the body becomes
apparently insensible to the ordinary
weaknesses and sources of pain, and
there is good reason to believe that the
ancient Christian martyrs were so
buoyed up by their faith and hope
that they were insensible to the tortures
inflicted upon them.

Without doubt there are more or less
charlatanry and pretense about alleged
mind cures, faith cures, Christian
science and the like; but there must
be some foundation of truth some-
where. The chief trouble-in discussing
this subject is in the fact that so little
is known of the actual causes of bodily
disease and of the processes which oc-
cur in the effecting of a remedy.

The origin of fevers, inflammations,
congestions and the like is always ob-
scure, and the treatment in nearly every
case is tentative or is the following of
an accepted routine. If the adminis-
tration of medicines were a mere matter
of chemistry, all would be plain saii-
ing, for then disease poisons could be
nullified with the same certainty that
the chemist enjoys when he neutralizes
an acid, or decomposes into harmless
constituents some noxious compound.

So little confidence can be placed in
the chemical operation of medicines that
it has been well said that ‘‘One man’s
meat is another’s poison, ’’ so different is
the diathesis or constitutional peculiar-

 

ity of various individuals. The human
body is a wonderful chemical labora-
tory, but we do not understand all its
laws. It is also an electrical laboratory
equally wonderful, but its laws and
operations are just as little understood ;
so that those who regard man as a mere
thing of organized matter, having, for
what is commonly known as mind, a
mere material emanation, just as if it
were an odor ora vapor, are not even
able to explain or a mere physical
basis the cause and cure of diseases.

If it be accepted that the human be-
ing has joined to his material organi-
zation a powerful, immaterial, spiritual
element, how utterly inadequate will be
any mere physical theory to explain
the mysteries of life. When once this
spiritual presence is recognized, it be-
comes impossible to set limits to it. It
is a something which not only pervades,
but it influences everything, and _ its
power over the body is acknowledged.

If this mysterious and potential in-
fluence can on occasion make men
insensible to fatigue, hunger and pain;
ii, of its own spontaneous action, it can
suspend some bodily functions and
quicken others, might it not be ex-
tremely valuable to be able to set in
motion at one’s will these powerful
mental and spiritual forces and control
them in the influence of our own well-
being or that of others?

Hypnotism shows that under certain
conditions one personality can exert
powerful influences over others. Why
should it not come to pass that man will
learn the laws of spiritual power, and
so become able to work it upon others
for good?

The entire subject of the power of
one mind over another, or of mind over
matter, is in a state of chaos, because
so little is known of it; but it is impos-
sible, when so much research and in-
vestigation are in progress, that the
laws which govern it will not be dis-
covered, and the ability to use it se-
cured. One of these days man is go-
ing to handle mind power with as
much ease and certainty as he does
electricity to-day.

 

ENGLISH RULE IN AMERICA.

An interesting result of the disaffec-
tion on the part of some of the officers
of the Salvation Army in this country
is that the attention of the public is
called to the fact that this semi-military
organization is dominated by alien
authority of the most arbitrary charac-
ter. It was, of course, generally known
that the ‘‘army’’ headquarters are in
London and that the movement is of
English origin, but it needed some such
means of directing the public mind to
the real situation to demonstrate the
fact that the degree of unquestioning
obedience required is no less arbitrary
than that enforced by the Czar of Rus-
sia.

Of course, there can be but one result
of this awakening. Americanism is too
important a factor on this side of the
ocean to permit the continuance of
English domination in so large and
rapidly growing an organization. Eng-
lish authority will be repudiated by the
greater portion of its adherents if, in-
deed, the yoke is not thrown off by the
entire body. Had the commander in
chief exercised a little more discretion
in the use of his autocratic power, it is
interesting to conjecture to what an ex-
tent his authority might have grown in
this country before public attention
should call it to account.

 

LEMON & WHEELER CO.

Wholesale

scl PE Piccccens
—- GRAND RAPIDS

 

OF COURSE YOU HANDLE

4LION COFFEE-

For Sale by All jobbers.

 

fon Ops 20000000060000000000000000000
er A >

ine : SEE PRICE LIST ELSEWHERE. o
i” IIE 3 sana
[. ele : EVERY PACKAGE 1b 02. NET
ie ait 3 WITHOUT GLAZING.
BN ile $ Perfectly Pure Coffee. 3
FF aN secccccoccoocoooooooooooooooes

es

WOOLSON SPICE CO.

TOLEDO, OHIO, and KANSAS CITY, MO.

 

 

OS OOOOO00O00000000S0S9HHSHOHHHOHHHHOHHOOOOOOOOOOOOS

ABSOLUTE TEAS

aoe

 

 

We are ke Importers of the

; above Teas. Write us_ for
ad samples and prices; you will
a save money by selling “Abso-
a lute Teas” only.

Michigan Spice Co.,

GRAND RAPIDS, MICH.

Millar’s Penang sploés

Gained the highest honors at the World’s Columbian Expo-
sition of 1893 that have ever been accorded to an Exhibit of
Spices known to history—for absolute purity, superlative
flavor, perfect milling, superiorstyle—scoring one hundred
points for perfection “of excellence in all.

9OOOOOOS 99900909 00000000 —

nh bh bp hb hb hb hb hhh hb hb bh bbb bbbo id hbbbhooaoe
PD VV VFRUGVU GOSS VOU VV VV VV VV VV VV VV VV VY

 

:

 

 

 

ee

Nothing but a comparison will demonstrate
the true merits of these goods. Merchants are
kindly requested to send for samples and com-
pare them with any line of spices in the mar-
ket. Quality considered, prices are the lowest.

8 SE. B. Millar & Co.,
5

Importers and Grinders,

CHICAGO.

Send for Housekeeper’s List of Fine Spices

wwe ee

Good Goods Create “Prade.
Poor Goods Will Trade.

 

 

10

THE MICHIGAN TRADESMAN

 

GRAND RAPIDS IN _ 1850.
CHAPTER VIII.
Written for the TRADESMAN.

In those early days, merchandising of

all kinds was confined to narrow limits.
It was all done on Canal street be-
tween Bridge street and what is now the
Morton House on Monroe street, the
bulk of the business being done at the
foot of Monroe, where the largest stocks
of all kinds were located. My friends,
the Messrs. Peirce, used to designate
that particular locality as ‘‘Grab Cor-
ners.’’ In retaliation the Monroe street
dealers spoke of the Canal street busi-
ness end as ‘‘away up in Kent¢’ I
believe that the whole of Grand Rap-
ids, before becoming incorporated as a
city, was known as the Village of
Kent. 1 can hardly realize, when visit-
ing Grand Rapids now, that the busi-
ness of 1850 was confined within such
insignificant limits.

John W. Peirce, on the west side of
Canal street, at the corner of Bronson
street (now you call it Crescent avenue),
kept the largest and best selected stock
of dry goods on the street. He was
popular with all classes of customers
and painstaking in everything he un-
dertook, also was very methodical in
all his business transactions. His
early mercantile training was under the
tuition of Nathaniel Gorham, in Canan-
daigua, New York, an accomplished
merchant of the old school. The writer
of this sketch was a clerkmate with him
in Mr. Gorham’s employ, in 1838. Mr.
Peirce was taught that good substantial
goods sold at a fair profit were cheaper
for his customers, fewer left-overs and
remnants accumulating, than cheaper
fabrics of poorer material, and his
business was conducted upon that prin-
ciple. In addition to his mercantile
pursuits he was for many years the
trusted agent of Charles Carroll, of
Geneseo, New York, who was, at that
time, the largest real estate owner in
Grand Rapids.

Mr. Converse, of Boston, owned large
interests in real estate on the West
Side, but at that time was making no
effort to sell.

Down on the west side of Canal
street, built directly over the old canal
basin, were two wooden stores, one oc-
cupied by Rose & Covell, the other by
Boardman Noble. Mr. Rose retired
from business in 1851 and moved onto
a farm, with the hope of enjoying bet-
ter health, but died soon after. I saw
Mr. Covell a few years ago. He was in
good health then. I have never heard
of his death and hope he still lives in
the enjoyment of a green old age. He
was a faithful friend and good business
man.

There were no dry goods stores on
the east side of Canal street and, in
fact, only a few stores of any kind. Mr.
Wade, hatter and renovator of hats, as
his sign read ; Bidwell (father and sons)
candy stere; John Clancy, groceries ;
Charles Mosely, postmaster, and James
Lyon, stationer and bookseller, on the
corner, are all that I recall.

At the foot of Monroe street, Roberts
& Sons handled goods of every kind
suitable for the Indian trade, as well
as for the general public. Mr. Roberts,
Senior, was one of the pioneer settlers
of Grand Rapids. The next store was
occupied by John Kendall. He carried
by far the largest steck of dry goods
in the city. His business was quite
extensive for those early times. Hon-
est dealing gave him a strong hold upon
his customers. Mr. Kendall held about

the same relative position among the

 

dry goods dealers at that time that
Henry Spring, Paul Steketee and Wil-
liam G. Herpolsheimer enjoy now.
Mr. Steketee was in the employ of the
writer two years and was then employed
by Mr. Kendall, under whose tuition he
graduated a competent business man, as
his successful mercantile career has
proved. Long live Paul! I can say for
him that, in my long business experi-
ence, | have never found a more faith-
ful employe than he was. Continuing
up Monroe street, might be found W.
H. McConnell, whom I have mentioned
before in connection with the hardware
business. The only dry goods store on
the opposite side of Monroe street was
that of James Lyman, who did a limited
business upon the spot cash principle.
I believe he was the only man I ever
knew who could do that kind of busi-
ness successfully for any length of time
without ‘‘falling trom grace.’’ I have
been told that, at the time of his death
and consequent closing up of his busi-
ness, he did not owe a dollar to any
man, neither did any man owe hima
dollar on his books. This fact, consid-
ering the universal credit system in
practice at that day, I consider most
remarkable.

Compare with the foregoing the beau-
tiful blocks constructed for all kinds of
mercantile pursuits that occupy the
limits | have described and the volume
of business now transacted within the
same limits, and mark the contrast.

W. S. H. WELTON.

Owosso, Mich.

—___ 0
Down With “Supply Houses.”
From the Minneapolis Bulletin.

Another ‘‘supply house’’ has sprung
into existence in Minneapolis and an-
other chance will be offered the farmers
of the Northwest to be gulled. The fact
of the matter is, while the ‘‘supply
house’ principle may be right, legally
and morally, it shouldn’t have the sup-
port of the farmer at all.

The ‘‘supply house’’ man is usually
quite smooth-—-most men are who are in
or emptying the farmer’s pockets as
fast as he can fili them. With the aid
of catalogues a ‘‘supply house’’ man
will sell a farmer molasses at 50 cents a
gallon which could be bought of the
home merchant for half the money.
Raisins are sold for to cents per pound
which the home dealer would be glad tc
sell at 5 cents, and so on through the
list. The ‘‘supply house’’ men, ir
many cases, openly boast of how they
bamboozle their farmer customers and
grow fat on the theory that ‘‘there’s a
sucker born every minute.”’

This is wrong-—the principle of **sup-
ply houses’’ is wrong and the Bulletin
would be glad to see the country mer-
chants expose the methods of ‘‘supply
houses’’ in their home papers, and point
out the matter to the farmers who are
being duped and robbed by smooth trav-
eling salesmen and_ seductive cata-
logues.

Country merchants should buy their
goods direct of the reputable jobbing
houses and, in turn, farmers should buy
of their home fnerchants. In this way
and this way alone can the farmer’s
purse be protected, but with the *‘sup-
ply house’’ men he is forced to buy ten
times as much of anything as he wants
and at usually double the cost. ‘‘ Down
with the supply houses and up with the
honest country merhcant and the honest
jobber, ’’ is our stand in the matter.

2.
Nutmeg Adulteration.

William Schroder, of Amsterdam,
continues to show up the adulteration of
nutmegs, and in his last circular has
the following: ‘‘I have been informed
that also at London larger lots of nut-
megs have been ‘doctored up’ _ for
America, bored nutmegs filled, ined
and mixed with odd goods. I think
that such manipulations may go once,
but must turn out at the end against the
sellers of such stuff. Fair competition
is a good thing, but it is a pity that the
competition has become so sharp that
it leads to such unsound operations. ’’

SSM REESE EEE

 

 

aa

 

 

ue
We may want You

Why? Because—we've been
appointed Agents for the

et

2

 

Bus

‘This means that we’re going to put our un-
tiring effort into pushing its sale. And there-
fore we wish to make connections with the
best house in each town for the purpose of
handling it. If you're that party in your town
get acquain’ed with us at once. It will mean
profit for you, as well as pleasure for us.

Please don’t get the impression that ‘*Grand
Republic’? is a new brand of flour. It 1s not.
It has been sold for years, and has always giv-
en uniform satisfaction. We feel that we have
raised the tene of our stock by securing ‘his
agency.

Now fora moment of undivided attention:
We’re not asking you to try an experiment.
We are asking you to handle a profit-making,
customer securing certainty. “To do it means
added reputation and c sh with only ordinary
effort. To ignore it means an opp. riunity for
your competitor to get the upper hand of you
in Flour matters. If y: u really mean business
speak quick.

The sow bird never g:tsamprs2. H: aw ays gets - eft.
You’d best to pattern after the other kind.

Ball-Barnhart-Putman Company. .
GRAND RAPIDS. i at

Bama aD aaa aa P IS SPR IS

Bispuaraaas

isa aa eae

 

DDDODQDDOQODQDHHHHYOD)

A BIG ©

=
facturing concern like ours can save you money. ©

We manufacture both Spring and Winter
Wheat Flour and sell direct to the retailer.
Send us your orders for small lots or car lots.

$$$ Of course, you see the
saved point?
It’s big enough, isn’t it?
. .

Our “Cro:by’s Superior’ brand of Spring
Wheat Flour has given better satisfaction in
many places than any of the so-called ‘‘High-
est grades of Spring Wheat Flour made.’’
There are reasons for it. We can name many.

TY LNG 4
- Grand Rapids, Mich.

 

 

 

SS

 

 

 

 

 

 

 

THE MICHIGAN TRADESMAN 11

 

Prefers Milkman Milk Now.
I said one day, the milk I buy

1s taken from the creek;
It isn’t fit for man to drink;

It makes me weak and sick.

And having spoken in this strain,
I went and bought a cow;

She had a soft and loving eye,
A lofty, thoughtful brow.

She was a mournful orphan cow,
A creature calm and mild;

The man who sold-her said that she
Was gentle as a child.

I said, to-night we'll have some milk
As pure as milk can be,

And then I took the pail and went
To milk her merillee.

That gentle creature humped herself
And kicked me through the roof,

And left upon my classic brow

The trade-mark of her hoof.

She caught me on her crescent horns
And heaved me o'er a tree,

And then came ‘round to where TI lay
And calmly sat on me.

She danced a polka on my chest
And jabbed me with her horn,

Until I wished. like Job, that I
Had never once been born.

My neighbors picked my pieces up
When that old cow was gone:

They put in splints my busted back
And glued my forehead on.

They riveted my shoulder blades,
And nailed my co lar bone,

And fixed me up in such a shape,
That I could walk alone.

And then I toddled off in haste,
Though feeling pretty sick,
To get the milk the milkman brings,
From somewhere down the creek.
> 0 > -

POLITICAL HONESTY.

Can a man be an uncompromising
party politician and be an honest man?

This is a question which almost any
observer of political movements and
methods is inclined to ask, and witha
very skeptical air at that. It is a ques-
tion which the Eon. Frederick  T.
Greenhalge, who died within the past
few days, while he was Governor of the
State of Massachusetts undertook to
answer in the February number of the
North American Review, and what he
said at that time may be considered as
almost his last words on political sub-
jects.

Governor Greenhalge was a man of
character and ability, as well as of high
position, and what he said on_ political
and personal honesty is worth attention.
He asks and answers the question,
‘*Can a_ politician be pure and practi-
cal? Yes. Must he be visionary in
order to be virtuous? Emphatically, no.
Truth and justice need less management
than falsehood and injustice, but intel-
ligent, well-disciplined forces are nec-
essary even to the cause of truth and
justice. Prospero must ever be on the
alert, even if Caliban is his only enemy.
Why does an honest, patriotic man take
office? Office seldom enriches the hon-
est, patriotic man. A list of the lead-
ing American public men to-day will
establish this fact. Most of them are
lucky if they have a competency, or,
indeed, escape bankruptcy. One of the
moving causes, then, must be ‘that
last infirmity of noble minds,’ ambi-
tion, the love of fame, of popular ap-
plause—in short, of glory. But is there
not blended with this motive, in| many
cases, a passionate love of country, an
intense longing innate in great souls

“To scatter blessings o’er a smiling land,

And read their history in a nation’s eyes?”
The sense of power exercised by a great
man for the welfare of his country, of
his fellow-men, must make him feel as
nearly divine as anything can.’’

It ought to be the first impulse of
every young man who isa citizen of
this democratic- republican country to
seek the political service of his coun-
try in time of peace, just as he would
fly to its defense in time of war. Real
statesmanship is not trickery and cheat-

 

ing. It is such care of the public affairs

that the finances are flourishing; the
taxes of the people are moderate and
the credit of the nation is good; com-
merce and industries are prosperous ;
the people of all classes are being fairly
paid for their labor, for their brainwork
and for the use of their capital; the
people are protected in their homes
from unwarranted intrusion; vice and
those who would propagate it are held
down with the strong hand of the law,
and criminals are swiftly and severely
punished for their evil deeds, and the
children are educated, while the peo-
ple enjoy perfect freedom in all matters
of religious and political opinion.

To secure all this is the duty and the
business of the highest statesmanship
and to maintain such a political fabric,
and to repair or improve it at need, is
a work that should call for the hearty
co-operation of every patriotic and hon-
est young man. But, if he starts out
on such a mission, he does not go far
before he is told that all the fine things
recited above have nothing to do with
practical politics; that principles are
out of place, and that party platforms
are merely to gull the public with, for,
with the politician, everything is self.

When the honest man learns that the
entire business of politics is to get office
and keep it, so that a few managers and
their followers may enjoy the benefits,
he is necessarily disgusted. What has
the out-and-out politician to do with
the people, save to use them for his
purposes? What has he to do with the
State or city, or any public interest,
except to plunder it? As for the party,
he only uses it as a cover for his oper-
ations; but he does not hesitate to dis-
card its platform and abandon its doc-
trines if they interfere with his personal
interests.

Such a politician is loyal to nobody
or nothing, unless it pays him to be
otherwise. He will subscribe to any
doctrine for profit,and will fight under
any political flag for pay, and there is
scarcely a political hack in any party
who has not at some time trained with
the opposition and only changed his
colors from mercenary motives. It 1s
useless to talk about political honesty
for such people. They could not pos-
sibly have it. Can they have private
and personal honesty? It seems impos-
sible.

Nevertheless there are among the
many rascals in politics some honest
men. The rascals are obliged to put
them in office in order to divert atten-
tion from themselves, and so the few
honest men are the sait that saves all
the other sinners, because they rescue
a city government, for instance, from
universal condemnation.

If there are too few good and patriotic
men in politics, it is their own fault.
If the honest men deliberately stand
aside and abandon the entire conduct of
public affairs to tricksters and sharp-
ers, then the honest men are alone to be
blamed, and, while they may claim
some consideration for their honesty,
they deserve none for their patriotism,
for they are the reverse of patriotic.

—~> 0

Druggist to Sell Gluten Flour.

An effort is being made to establish
a sale for gluten flour in the drug trade,
and it is thought that, while it is a con-
venient article for handling, the sale
of gluten flour will drift into the hands
of the family grocer. It will unless the
druggists bestir themselves. The bread
made from gluten flour is not only more
healthy but is also more palatable than
Graham flour. It is sold so cheaply
now by the wholesale druggists that it
costs but little more than common
white wheat flour.

 

   

Be

Ss OO Mall

Means much. It gives the con-
testant a decided advantage over

 

 

 

= all opponents and once in the

uae lead it is easier to keep there than
: for the other fellow to recover lost
>

ground. The race for business is
governed by the same points of ad-
vantage and the buyer of confec-
tionery who reaches out after the
shekels of the public in exchange
for the newest, purest, most at-
tractive make of specialties has
‘‘a good start’’ of back number
competitors who always. defer
taking hold of an article until

“everybody else” has it. Our
products are characterized by all
the essential elements that go to

 

 

 

 

~oeee make up what the people want
ae and you are invited to insist on
an getting goods bearing our Trade-
8 mark. Respectfully,

-200@

a33 PUTNAM CANDY CO.
a GRAND RAPIDS.

 

 

 

oe

ISIS RSIS ISIS ISIS ASFSISIS IS ISHS

General Stampede

oe

 

 

From the Curse of Credit.

 

 

Hundreds of merchants are now

abandoning _ ‘the old-time _ credit

system and discarding the pass
book for the c cash and coupon book

system, which enables the dealer

to avoid all the losses and annoy-
ances. inseparably connected with

the credit business.
If you are at victim of the credit business
and desire to place your business on a cash
basis, send to us for a catalogue and samples

of our several kinds of coupon books, which

 

4
ile

 

 

 

will be forwarded free on application.

TRADESMAN COMPANY,

Grand Rapids, Mich.

PSPSPS PSISPSHSPSISPSIS IS ISIS IS

DADA AAAAAATAADRA

AAASAADASBSAAEAAA
oh

ou

 

12

THE MICHIGAN

TRADESMAN

 

NEW WAYS OF LIFE.

What a very pretty woman she was.

John Preston hi .d been talking to her,
or with her, for an hour, and though
he had never heard of her urtii that
evening, and the turmoil and tragedy
of a great society function were roaring
all about him, he had not found it diffi-
cult to give to her his absolute atten-
tion. Indeed, he was absorbed in her ;
so absorbed that he did not even know
her name, and cared less. It was the
woman herself as the Creator had made
her, not the label man had put upon
her to designate who or what she was,
that was exerting this influence upon
him.

‘Have you ever heard of Miss Park,
of Chicago?’’ she asked him, after they
had begun to reach out into the realm
of acquaintanceship to bring to their
growing interest in each other a few
jandmarks by which to be guided.

**Is she of the Lincoln Park or Jack-
son Park families?’’ he inquired lightly.

She turned her eyes on him plead-
ingly.

‘*Oh,’’ he hastened to apologize, *'1
beg your pardon. I forgot I was in
Chicago. You know I have been living
in Boston for a year and have fallen
into the intellectual habits of that
town.”’

The apology was almost as_reprehen-
sible as the offence, but she nodded her
acceptance of it and took up the thread
of her inquiry.

‘*She was a lovely girl, so pretty i

‘*As pretty as you?’’ he interrupted.

She arched her eyebrows, _ half
pleased, half disapproving.

‘*So pretty,’’ she went on, ‘‘that the
men raved over her, and so sweet and
kindly of manner and careful of speech
that the women loved her. She was
such a girl as you would have wor-
shipped, and I fancy she would have
made a hero of you, for you are such a
man as I have heard her say that man
must be who could fill to the brim the
measure of her ideal.’’

Preston felt the force of this covert
compliment and would have made some
reply, but she did not give him time.

‘*] think,’’ she continued, somewhat

hurriedly, ‘‘that you spoke of having
lived in Boston. Did you ever
know——’’

The hostess interrupted her.

‘*Oh, Mrs. Terhune,’’ she exclaimed,
‘*have you seen my husband? He was
looking for you some time ago, and I
want to see him about a carriage for
Miss Bertrand. I’m awfully sorry to
interrupt this charming tete-a-tete, but
it could not possibly be helped.’’

‘*We’ll pardon it,’’ laughed Preston,
‘if you will tell your husband not to
repeat the misdemeanor. ’

The hostess laughed, Mrs. Terhune
blushed charmingly, and assured the
lady she had not seen her husband, and
Preston wondered if there were a Mr.
Terhune to make a nightmare of this
delightful dream of his.

‘*You were going to ask?’’ began
Preston, as the hostess departed.
‘*Whether,’’ resumed Mrs. Terhune,

‘‘you had ever known in Boston any
one of the name of Groton.’’

‘*T knew slightly an elderly woman
of that name who lived with some dis-
tant relatives of mine,’’ said Preston,
after thinking a moment. ‘‘In fact, I
might say she was an old woman.”’

‘*Had she a son?’’

‘*Not that I ever heard of. But she
may have had a dozen,’’ added Preston.

‘*She had one,’’ said Mrs. Terhune,

|

 

'so coldly that it almost sent a chill

down Preston’s back.

‘How do you know?"’ he asked in so
much surprise that the oddness of his
reply did not occur to him.

‘‘l married him,’’ she
frankly.

Preston was startled by this confes-
sion,for it came to him asa confession,
notwithstanding marriage as a rule is
not one of the hidden secrets of a man
ora woman’s life. It was her manner,
perhaps, that affected him, and, per-
haps, it was the fact that she was now
Mrs. Terhune.

‘*But you are not Mrs. Groton?’’ he
said, inquiringly.

‘Oh, no,’’ and now she laughed with
a lightness that might have been nerv-
ous; ‘‘you must understand that it is
possible in this country for a woman to
marry again, and | married again. Ed-
ward Groton,’’ she said in a harsher
tone than Preston thought such a_ sweet
mouth could frame, ‘ was my first
husband. I was only 18 then, and the
world was very fair to me, so fair that
| thought all who composed it were fair.
I am older now ——’’

‘*Not a great deal,’’
softly.

‘*Oh, yes, a great deal.’

‘Three or four years, perhaps?’’ and
there was a question in this remark of
his, for he had been wondering how
old she was.

‘Both,’’ she said, with a candor un-
usual among women on a point of age,
‘and then a few years. 1 am thirty.’’

answered

he interrupted

The answer pleased him, for he was
4o, although he never confessed it.

‘‘The most delightful period in a
woman’s life,’’ he said heartily.

‘Thank you,’’ she smiled very gently.
‘*But may I go on with my story?’’

‘*Really, I beg your pardon,’’ he
said, ‘‘but my interest in your present
makes me forget the interest I should
have in your past. You were saying
the world was fair to you in those first
days. Is it not so now?”’

‘‘Only as one catches glimpses of the
light. Then it was all sunshine; now
there are gray clouds. Yet I have not
lost all my trust in man, and there are
moments when even the bitterness that
has tinctured my life disappears, and I
feel that there is still sweetness in the
cup.

Preston experienced an impulse to
draw nearer to her, and he yielded to it
promptly.

‘‘After two years of married life,’’
she continued, ‘‘my husband’s conduct
became such that I found it impossible
to live under the same roof with him.
Then I went back to my girlhood home,
not broken hearted, but oh, so hard and
so unlike the girl who had gone forth
under the orange blossoms and the
sunshine and the faith that women have.
Within a year I had secured a divorce
and was once more free. Do you be-
lieve in divorce?’’

There was a pleading in her voice
and her eyes were moist. What answer
save one could a man give to a wom-
an’s question under such circumstances?

‘‘Indeed, my dear Mrs, Terhune,’’
he said earnestly, ‘‘I do. What other
course was left to you? Marriage is at
best a lottery, and surely if one draws
a blank it is hardly fair that the draw-
ing should end there. I am sure you
acted quite right in the matter, and I
respect you more for it than if you had
suffered in silence and taken no means
of self-defense.’’

She touched him on the arm impul-
sively.

Ai slight jerk--the spring does the rest

Pointers on es Shades
RG We have them in all colors, styles and
is money in it for you. fone cleaning
= means new shades. Do not de-
WHOLESALE DRY GOODS
GRAND RAPIDS. MICH.

 
    

— Packed in boxes of a dozen
oe
Calls lay but place your order now.

VOIGT, HERPOLSHEIMER & 60.

 

 

 

 
  
  
 
   
  
  

SPRING & COMPANY

IMPORTERS and JOBBERS.

Show

==~Qenly Fumnishing 600d

Ever Offered by Them

Their new Spring Goods, including White Goods, Prints,
Ginghams, Embroidery, etc., are very inviting.

; GRAND RAPIDS.

 

pholsterind G00ds

Curtain poles and trimmings, extension
rods, curtain fixtures, window shades,
opaques, all widths, staples, shades for
curtains and a complete line of draperies
and mulls for fancy curtains. Write for
prices.

P. STEKETEE & SONS,

GRAND RAPIDS.
Established 1862.

 

O. E. BROWN MILL CO.

SHIPPERS OF

FLOUR, GRAIN,
BALED HAY

In Carlots.

Western Michigan Agents for Russell & Miller
Milling Co. of West Superior, Wis.

Office 9 Canal street, Grand Rapids,

 

pO. et

 

THE MICHIGAN TRADESMAN

 

 

‘‘Oh, I am so glad to hear you say
that,’’ she exclaimed. ‘‘As long as
you think I have done right, it makes
little difference to me what others may
think. ’’

Preston very nearly forgot there might

be a Mr. Terhune, but he remained
calm.
‘‘I know of an instance similar to

yours, I think,’’ he said, with the evi-
dent purpose of proving his opinion
on the subject. ‘‘An acquaintance of
mine several years ago married a_ girl,
in this very town by the way, and if he
wasn't a scoundrel there never was one.
I never knew the woman, his wife, but
I heard she was far too good for him,
and I really felt sorry when I learned
that he had fooled any woman _ into
marrying him. He was past redemp-
tion, and an archangel in petticoats
couldn’t have saved him. Well, the up-
shot of it was that withina year she left
him and got a divorce, and ever since,
knowing that fellow as I did, I have
looked upon divorce as one of the
greatest blessings of married life.”

‘*I don’t want you to think me_ over-
curious, Mr. Preston,’’ she said, hesi-
tatingly, ‘‘but may I ask you to tell me
the man’s name?’’

‘*T haven’t the least objecticn to tell-
ing you. He was a brute on general
principles, and his name ought to be
known, just as a skull-and-bones label
ought to be put on a bottle of poison.
He was one Frank Hart, and fortunately
he died about three months ago.”’

‘‘Frank Hart!’’ exclaimed Mrs.
Terhune. ‘‘Why, that is the name of
the man who married Miss Park. Was
he from New Orleans?”’

‘*Yes;and he died here in Chicago.’”’

‘It must be the same. I know it is.”’

‘And is it the same Miss Park you
told me of?’’ said Preston. ‘'The
lovely girl who might make a hero cf
me, and to whom I might be a hero-
husband?’’

Mrs. Terhune became fidgety and
half rose from her place beside Preston.

Preston himself was not half as inter-
ested in Miss Park as he was in Mrs.
Terhune.

‘*The same Miss Park,’’
him with evident effort.

‘*And where is she now?’’ he asked.

‘‘Here; beside you,’’ and Mrs.
Terhune was unequal to further speech.

Preston gasped for breath, and it was
a minute before he could say a word.

‘“W—w—w-—what?’’ he stammered.
‘*Aren’t you Mrs. Terhune?’

‘*Not since last week, ’’ she responded,
calmly enough, now that the man had
lost his balance. ‘‘My decree of di-
vorce from Mr. Terhune was signed six
days ago, and I resumed my maiden
name, but my friends haven't quite be-
come accustomed to the resumption.’’

Two seconds later John Preston's
mind had undergone a great change.

W. J. LAMPTON.
—___» 0».

Some comment has been caused by
the action of Messrs. Morris and Swift,
the big Chicago packers, incorporating
the National Leather Co. for $25,000.
Some have gone so far as to predict a
tremendous tanning plant or plants and
active competition to the United States
Leather Co. The packers, on the other
hand, claim that they have long tanned
hides and that incorporation is merely
a formality to systematize this business.
The truth is doubtless midway between
these two extremes. If the venture
proves successful the tanning feature
will probably be extended and in time
may grow to huge dimensions.

——__o2o > ___

Truth is the child of Time, and will,
in the end, vindicate those who follow
her teachings.

she told

 

A Country Premium Scheme.
Stroller in the Grocery World.

I strayed into a queer sort uf concern
last week. It was so queer that I really
enjoyed the experience. It was a gro-
cery store and photograph gallery com-
bined, and did business way out ina
little one-horse place in one corner of
Pennsylvania. I went in more out of
curiosity than anything else, for it was
the only grocery in the place, and |
wanted to see whether the proprietor
made good use of his monopoly.

It was just like the average little coun-
try store—no more nor no less—except
that one corner of it at the back was
curtained off. My attention was at-
tracted by this as soon as I entered, for
| heard somebody laughing behind it.
I asked the store boy where the pro-
prietor was, and he jerked his thumb
back toward that curtain. In a minute
I heard somebody behind it say:

‘*Look pleasant for a minute. There!
All right.”’

‘‘All done?’’ queried a feminine
voice, and the first speaker gave an
affirmative answer.

Then it dawned on me that I was in
the presence of the town photographic
studio. Just then a buxom country lass
came out from behind the curtain wear-
ing a conscious smile and a green rib-
bon.

She soon went out, after inquiring of
the grocer, in a country whisper, *‘ how
long before it would be done,’’ and
then I approached the proprietor.

‘‘Running a photograph place, too,
eh?’’ I said.

‘Ves’ was the
‘‘premium scheme, ”’

‘*What!’’ | said, in surprise.

‘‘This is my plan of giving pre-
miums,’’ explained the grocer. “‘It
works, too,’’ he said, with a significant
smile.

‘*How can you, give photographs as
premiums?’’ I asked.

‘‘Easy enough,’’ was his answer.
‘*VYou see I’ve got the only photograph
place in the town. The people here
wants their pictures took just the same
as the people in Philadelphia do. I
only take tintypes,’’ he said, ‘‘and I
made up my mind long ago that I
ought to_be gettin’ more grocery trade
from the country. There’s two or three
bigger towns near here where there are
more stores, and the country people got
to goin’ there because they put on more
style.

‘*But I fixed all that,’’ he went on,
with a chuckle. ‘‘I got out a circular
that said I wouldn’t sell any more
photographs. The only way reople
could get ‘em was by takin’ ‘em as
premiums, and they would get four
pictures with every dollar’s worth of
groceries. ”’

‘*Did it work?’’ I asked.

‘*Work !’’ he ejaculated, ‘‘ well, rather!
I have all I can do. Tintypes is cheap
to take, and I’ve got a pretty good out-
fit. People seven miles away from here
buy groceries they don’t need just to
get their pictures took, ’ and the old
fellow grinned at me over his glasses.

‘Well, you’ve certainly hit an_origi-
nal idea. None of the big Philadelphia
stores do this,’’ I said, gravely. ‘* Not
even John Wanamaker did it when he
had his grocery store.’’

‘*They ain’t got brains enough,’ he
ejaculated, complacently. ‘‘They think
us country fellers is green, but we
knows a thing or two all the same.
Want yer picture took?’’ he said, hos-
pitably, but I declined with thanks
and lett.

Verily, for originality, pure and sim-
ple, commend me to the country grocer.
> 2.

Straight from the Shoulder.

‘*What is it, little girl?’’

‘‘Mamma sent me for a lamp chim-
ney, and she says she hopes it will be
as strong as that last butter you sent
us.

»”

laconic answer;

/ +> 2. —__—_

The merchant who fails to take an ac-
count of stock usually employs an as-
signee for that purpose.

Rubber Stamp

Rubber Stamps =#=:25

pate ae 99 Griswold Street......

 

 

Detroit

Se Stns sete aUeE NES
. HAS NO EQUAL

re
e FOR CARRIAGES AND HEAVY WAGONS Rus
3

 

 

Never Gums

Keeps axles bright and cool.

1 Ib. ) \4 doz. in case.
3lb. + TIN BOXES < 2 doz. in case. 25 1b. Wooden Pails.
5 lb.) {2 doz. in case.

Half Bbls. and Bbls.

Scofield, Shurmer & Teagle,

GRAND RAPIDS.

UA NU Alp ait

seers

a3

 

 

 

fxs
2

 

 

 

SC RRAL aCe cunenne

5

ay

| Standard Oil Go.

DEALERS IN

ee,
a

fenets

 

a

Bs

3

taatgoite

Iluminating and Lubricating

OILS

Naptha and Gasolines

Bsmiseses

zs

a ee
Office, Mich. Trust Bldg. Works, Butterworth Ave.
GRAND RAPIDS, II1ICH.

we Ee

BULK WORKS at Grand Rapids, Muskegon, Manistee, Cadillac,
Big Rapids, Grand Haven, Traverse City, Ludington,
Allegan, Howard City, Petoskey, Reed City.

Highest Price paid for Empty Carbon and Gasoline Barrels

Sr eacsars apap ara eaese sess

ACCC aC NC

og

 

it

THE MICHIGAN TRADESMAN

 

_Shoes

The Traveling Man’s Duty.

From the Shoe and Leather Facts.

and Leather

 

 

An interesting discussion took place
in one of our contemporaries recently
on the question as to whether the trav-
eling man should also look after credits
and collections. While in the general
acceptance of these terms they might
not come within the purview of his
work, still there can be no doubt that
the salesman who does not closely look
after the interests of his employer by
not selling to those whom he has rea-
son to believe are not financially re-
sponsible, or by urging the payment of
overdue accounts where possible, is not
serving him as he should. Manufac-
turers and wholesalers, from the very na-
ture of their business, are not brought
in personal contact with most of those
from whom they seek trade. Many an
employer, consequently, must place
implicit reliance on what his traveling
men tell him on this subject, and be-
cause the traveling men have {seen
those who are asking credit they natur-
ally should know more about them than
can those who have not had that ad-
vantage. Not that the traveling man is
expected to be a mind-reader, or go in-
to any extended investigation unless
given special instruction to do so. The
traveling man, if he is observant, is in
most cases able to judge from surround-
ings, inquiries, appearances, and
probably it would not be too much to
say—by natural intuition after a few
visits as to whether it would be safe
to extend credit in any particular case.

On the other hand, if he exercises his
best skill and judgment, he should .not
be too severely censured if he arrives at
a wrong conclusion. A writer on this
subject very aptly says that a good
many dealers who were said to be ready
to fail five years ago are still doing
business at the old stand and paying
their bills—although perhaps siowly-
while others who were represented by
the mercantile agencies and by com-
mon report to be ‘‘as good as gold’’
have long since gone to the wall. Of
course, there are firms which entirely
relieve their salesmen from any re-
sponsibility in the direction indicated.
They simply expect them to secure the
orders, leaving it to the decision of the
creditman atterward whether such or-
ders are to be filled or not. We do not
refer to firms of this kind in taking up
this subject. Undoubtedly the average
salesman has a sufficient burden to bear
without imposing an unnecessary one
upon him, and where he can be relieved
from everything but the immediate
work in hand it is calculated to consid-
erably facilitate matters.

oe
Purple Leather Next in Order.

Dressed in purple has always been an
insignia of royalty and tanners are
anxious nowadays that this ancient and
regal hue be once more popularized,
but this time by all humanity, so far as
footwear is concerned, and they are ex-
perimenting with purple dyes at heavy
expense to obtain the desired shade.

Purple, be it known, is a color that
is most difficult to produce satisfac-
torily. It was this quality as much as
its beauty that made purple royal—it
was the most costly. The Tvyrians
achieved great success in the dyeing of
purple and the fame of Tyrian purple
lives to this day.

This is merely recited to show the
great ambition of upper leather tan-
ners. Never in all the world’s history
has there been tanned a leather suitable
for footwear to-day that has been fin-
ished satisfactorily a purple hue.  Sat-
isfactorily in this case means uniform-
ly. Small pieces .of leather have been
made of an excellent purple shade by
chemists, but turning out a purple
whole side is a different thing.

The trouble is that the leather has to
be ironed and heat is deadly to purple.
It drives it back into the original blue
or yellow. Here lies the difficulty and
a dozen firms are trying to overcome it,
each knowing that the first one of them
to put on the market a novelty in the

 

shape of a uniform and durable purple
stock will reap a tremendous harvest.

There are a number of uses for which
this shade would be demanded. Men's
shoes, women’s shoes and shoes gener-
ally would be made of it, besides belts,
pocket-books, valises, etc. Purple imi-
tation alligator and other fancy leathers
are being experimented with and would
sell, ‘Tanners and chemists, however,
have as yet made little progress and
hence anybody with a good, sure pur-
ple leather dye concealed about his per-
son can learn a good deal to his advan-
tage by communicating with the right
tanner.

+> 02 —
An Expert on Patches.
From the New York Sun.

‘*l thought I was a connoisseur in
patches,’’ said the man of moderate
means, ‘‘for I had four patches on each
shoe. I used to laugh as I looked at
them and fancy that ] might almost call
myself an expert. But alas! as I soon
discovered, I was scarcely more than
an amateur. is Ac

‘‘In the course of time a new crack
developed in one of my shoes, in the
upper, crosswise of the shoe*and about
midway between the sole and the top or
highest point of the shoe. At the same
time a patch along the welt on the same
side started loose, and I took the shoe
to the shoemaker. He had put other
patches on my_ shoes in the most per-
fect manner and he had always treated
me, when I came for a new patch, with
the same politeness as though I had
come each time for a pair of new shoes.

‘*He looked the shoe over and said he
would make one patch to cover both
places, the place along the welt and the
new crack inthetop. This was obvious-
ly the thing to do; it would make one
patch instead of two, and so would look
better, and, with its greater area and
wider distribution of the wearing strain,
it would last longer than two smaller
patches. So he put it on that way,
running along the welt and then mak-
ing a turn and running up to cover the
crack in the top.

‘‘As I looked at the new L-shaped
patch I realized how limited my _pre-
vious knowledge of patches had been. I
had had many patches, but they had
been but commonplace, just plain, or-
dinary patches, but as I looked at the
new patch and looking down at my
shoes I saw in them (and in the near
future, if | would keep them in repair),
the prospective need of other patches,
alphabetical and geometrical I knew
that I was now in a fair way to become
an expert indeed. ”’

- —> 30> -
Knowledge Comes High.

A little information is sometimes a
very valuable thing in a tannery as well
as elsewhere. A well-known tanner had
an illustration of this not long since. A
certain preparation he had been trying
could not be made to do what he wanted
it to. It came very near it, but not near
enough. He went to a gentleman expert
on the subject and asked his advice.

‘‘What is it worth to you?’’ asked
the latter. ‘‘Fifty dollars,’’ responded
the tanner. ‘‘All right; add five cents’
worth of oxalic acid.’’ ‘‘Is that all?’’
‘‘That’s all.’’ ‘‘Great Scott! Must I
pay you $50 for telling me to buy a
nickel’s worth of stuff?’’ ‘‘ Worth it,
isn’t it??? ““Yes.”’ “Allright. Come
down with the fifty.’’ The tanner came
down.

> 0. --—

Possibly the most expensive cigars
ever made were the 20,000 Havanas
made for the Spanish Marshal Prim, as
a present for Napoleon III, each cigar
being stamped with the imperial N, in
gold. They are said to have cost
$15,000.

__—__—~» 0.

No lion ever expects to arbitrate with
alamb. It is much quicker and more
satisfying to eat the lamb.

 

 

 

 

DOOQOQOOO© HODDOOOSGOGOOOOMQGQOOPQOOOQGOOOE QOOOQQODOGCOOQOOOO
@)
©

.. HEELERS...

We are HEELERS in ournparticular line and
can do you more good than Schlatter, Burke or
Elder Buck. If your trade is off, you can im-
prove it by putting in our lines of: footwear, each
one having a record which CANNOT be beaten.
For instance, our Hard Pan, Mechanic Bals,
Police, Veal Calf, Oregon Calf, Satin Oil, Star
Line,
Amazon, 16 inches high, Grand Rapids and
These lines have built up our busi-
ness—and will do the same for yours. Give us
an opportunity to prove to you the truth of our
statements. Agents Boston Rubber Shoe Co.

  

Drovers).

and our new Rivers (the

RINDGE, KALMBACH & 60.,

12=14=16 Pearl St.
QOODOOOOOOOOOOOO

 

OOOQQOOOQOQOGDOCMOOODOOQOQOOOOOE)

Grand Rapids.

@

  
  

GPOOQOOQOOQ QOOPQOOQQDOOQODOOQOVO)

QOMOOOQQOQOOOOO®

 

Don’t wait till the “Beautiful” is all gone

but give your best thoughts for a moment to your

RUBBER DEPARTMENT

Won't the Boots, ete., want sizing up?

If you are looking for Winners

WALES-GODDY EAR

are the kind.
**Best on Earth and in Water.’’

nel Pee

Our Connecticuts are the best “grade” Rubber on
the market to-day. Try US and be con-

vinced of their superiority.

Herold-Bertsoh Shoe 60.,

  
  
 

5 and 7 Pearl street,

Grand Rapids, Mich.

 

     
   
 
    
 
  

  
    

iti a

are the best.
orders at once.

engnee
We want you to see th
We want your order.

r
leather.
will do you good.
agents for Lycoming and Keystone Rubbers. They

Our Spring line
of samples are
being shown by
our representa-
tives on the road
and the prices are
based on to-day’s
latest price of

em as we can and

State

Stock full and complete—can fill
Send us your order.

REEDER BROS SHOE CO.,

GRAND RAPIDS, MICH.

 
   
  
   
  
   

 

cannot meet.

Dur Shoe Department

Is your stock complete for spring trade? Look it over and
write us for samples in Misses and Children’s.

Our Bob and May is the best grain shoe made.

For a Kangaroo calf, we can give you one that competition

IP You ought to see our Berlin Needle toe, Misses’ and Childs’

a
e@
a
e
a
e
a
e
RB
@
a
e +;
a
@
> any made.
a

@

a

@

a

®

a

e

a

e

Dongola; this is the neatest shoe out for spring.
Our Little Gents’ 9-13, I-2 is on Needle Toe and as tony as

Our Rochester Misses and Childs’ Dongola they all swear by.
Send us your order for turns 2-5 and 4-8.

Hirth, Krause & Co.

GRAND RAPIDS.
HONOROROUOROROROROHOROHORONOROHORONOHONOHOHOHOHOHEE

 

 

:
3

 

 

:
é
x
4

a
i

 

wrens ae

 

 

 

THE MICHIGAN TRADESMAN

 

rol
or

 

MEN OF MARK.

J. Sydney Baxter, Manager Baxter
Register Co.

No, sir, Mr. Baxter is not in at
present; but he will be here socn, if you
care to wait.’”’

It was the best thing to do and, dur-
ing the wait which followed, the imag-
ination was busy picturing the inventor
of the Baxter Register. Tall, of ccurse;
thin, of course; bent just a little; hair
just a little gray; face rather elongated
and inclined to the cadaverous. Care-
less as to matters of dress and, like all
inventors, somewhat inclined to be
dreamy. ‘It was only a snap-shot, but it
was hardly completed when the door
opened and a young fellow who had just
caugat up with his thirtieth birthday
was announced as ‘'Mr. Baxter!’’
Truly, ‘we live in deeds, not years ;"’
and the reader will agree witb that
thought from ‘‘ Festus’’ before he reaches
the end of this life sketch.

Mr. Baxter was born at Niagara
Falls, on the Canada side, in 1865, one
of the best‘ birthplaces in the world for
a man who is to live in Chicago; for
the sound of that mighty cataract pre-
pares him for the greater roar of that
tempestuous city and, if he is inclined
to invent things, will early set the
wheels a-turning. His school life be-
gan at six; and, when it is stated that
ten years cover not only the lower
grades but the high school, so that at
16 he was graduated from the high
school, there is, to the thoughtful, a
suggestion of the lively brain in the
head of the newly-fledged graduate.

With his school work done, he went
into a store, where he became familiar
with the handling of groceries, with
boots and shoes and, lest time might
hang too heavily on his hands, with the
duties of the telegraph office connected
with the establishment. At the end of
a year the store was disposed of. The
next venture was in the line of drugs,
with an M. D. as the head of the con-
cern. Three months were long enough
to find out that that was too much of a
good thing; and then, above the roar
of Niagara, the boy heard the louder
voice of Chicago calling him, and
away he went.

In that large city he had a friend—
or thought he had one; but time had
gone by since they had been to school
together and the boy soon saw that
the friend had not ‘‘the show of love
that he was wont to have.’’ That point
settled, the young fellow went out to
fight for himself. It was no easy bat-
tle. Just then nobody seemed to {be in
need of a good likely country lad to
help carry on the business, and day
after day, weary with endless walking
and endless refusal, the boy kept up
his search for something to do, until
there he was, a boy off17, away from
home and reduced to his last dollar.
Then the sun broke through the clouds,
and in all probability it never shone
quite so pleasantly to that Baxter boy as
it did that day when he joined the
forces of C. W. & E. Partridge, a dry
goods house on State street.

It may be easily inferred that, after
that piece of experience, the boy made
up his mind to make the most of the
job that at last came to him. And he
did. For six good years and a half he
toiled early and late. He began low
down in the scale. At the end of his
career there, he was Assistant Manager ;
they who have traveled the same road
know what that means. It was no
‘flowery bed of ease’’—-in fact, there

 

was precious little of the bed about it
anyway, and it was not surprising that
he was obliged to say to the concern,
one day, that he could not stay any
longer. The confinement had been too
great for him, his health had been un-
dermined; and, with the hope of re-
gaining what he had lost, he betook
himself to camp life in the Canadian
woods. There, in the healing balm that
comes from the breath of the pine and
the hemlock, with gun and_ fishing
tackle he wrestled with the disease that
had threatened him. At the end of nine
months in those spicy woods, he came
from the struggle a victor.

When he came again to the roaring
city, he entered the register business.
The more he learned of it the more he
liked it. New ideas came crowding
up. He began to see visions and dream
dreams. They materialized. The busi-
ness world caught the idea and wanted
it. Two years ago, there was a_ patent
secured. Recently, a new machine
made its appearance, with an improve-
ment wholly Mr. Baxter’s own; and
those of his friends who know the work
and the constant discouragement which
comes with it will rejoice at what has
been reached already and will hope for
still better things to come.

Mr. Baxter was married October 16,
1895, to Miss Agnes B. Gross, of Chi-
cago, where he resides at 315 Flournoi
street.

After reading the story, one likes to
go back to that period when, all alone
in the world and with constantly de-
creasing funds, the young man of sev-
enteen was walking dejectedly the
streets of Chicago and wondering when
and how it was all to end. Those are
the times that try men’s souls, whether
old or young, and those are the times,
too, when the best life lessons, uncon-
sciously taught, are learned. And the
moral of them, when the story is told,
sinks deep into the mind of the reader
and stays there, for, what man has
suffered man may suffer again, and
what has overcome that suffering once
may be again the only means for the
sufferer’s happy release.

> 0

It is generally held that a man may
think what he pleases so long as he
keeps his thoughts to himself. It is
only when he does too much talking
and too little thinking that, asa general
thing, he gets himself into trouble.
Cautious people, who do not wish to
commit themselves, say they have their
opinion of this or that, but they keep it
to themselves. In England _ this
reticence does no good, and a judge has
just decided that a man is responsible
for what he thinks, whether he tells his
thoughts or not. The mind-reader,
Stuart Cumberland, recentiy wrote a
book entitled: ‘‘What I Think of South
Africa ’’’ After discussing everything
else pertaining to that part of the world,
there was a chapter on ‘‘What | Think
of Cecil Rhodes,’’ in which the pages
were blank paper, without a word
printed on them. Mr. Cumberland may
have thought more highly of Cecil
Rhodes than he could say or he may
have had some. stock in Mr.. Rhodes’
bubble schemes, and thought he was a
blank swinder. There was no evidence
to show what he thought, but the judge
held that those blank pages were libel-
ous. A good many people will think
we are getting too much law when a
man can be prosecuted for his unex-
pressed thoughts.

>eom

The Keeley stockholders have — ad-
jeurned until April 2 to receive the
final account of that wonderful force
and marvelous machine. They made it
one day too late.

a

Conservative business men are the
kind of men to build up a community,
but fogies are not conservative business
men.

 

be ba.dadahatonhnhhn La Le Mn hn Mn Me he Mer he Mn Mee Me Mr hi Mn hn hn te Mr Mn Mn hn Mr

THE x

— a) \

 

&

of selling rubbers was to fit a customer as nearly as
possible from the stock on hand, and “let it go at

that.” Anything to make a sale.
wea Th: “ 2c7)" - , Yer » antr here ¢
Xan That “doesn't go” now. People want rubbers to

fit the shoes, some neat and stylish article to
make the foot look well. Why not give them
what they want? You can get every style made
by the BOSTON RUBBER SHOE CO. in widths

and sizes, and at any time, of

ASW

W. A. McGRAW & CO.,

MHOLESALE RUBBERS.

DETROIT.

 

PVE CPF E VE FUE CE EEE EEE EET OSTEO CEES

 

|

 

 
  
  
       

exe

bk 2

OCOKOXKe
—
=
Ss"
cw
me]
a2
co
e

ee

     

g Grand Rapids, Mich.
e@ 508, AOD and ALD fe
: Widdicomb Bld. &
e ‘e
O} 7 of rk ©
®) NW. B. CLARK, ©
@ Pres. @)
¢ W. D. WADE, ©
© 1 Sie Sees. ©
@ c. U. CLARK, e@
e Sec’y and Treas. ©&
) ©

— @

We are now ready to S

make contracts for bark @

Pe for the season of 1896. @

e an NI (e)

— “ = Correspondence Solicited ©

@)

COP POQOOQOQOQOGQOOOOOGOCOOQDOOQOOE DOODOQOODD DQODOOCGOGOOOHE ro}

  

 

|
!
(
!

Into the future would en-
able almost anyone to
make advantageous
deals, but dealing in fu-
tures is not our business
We are, however, making

He NEWTON

which are simply elegant.

~~ GATHODE
NS

reveal no imperfections in this superior piece of goods,
which is a very choice cake with a rich fig filling

bd
O

a
°

Try a box with your next orjer and convince your trade
that they do not have to go to the other dealer’s store to
get the finest goods made.

This delicious cake is manufactured by

New York Biscuit Co.,

GRAND RAPIDS, MICH.

XS
Ee

}
}
|

 

 

16

 

THE MICHIGAN TRADESMAN

 

PERNICIOUS SYSTEM.

Phenomenal Growth of the Installment
Plan.
Written for the TRADESMAN.

A decided improvement in the matter
of credits has taken place as a result
of the agitation that has been going on
for some time past; but with this im-
provement there has developed a form
ot credit that is already doing much
to counteract’ the benefits of the cash
system. Not many realize the extent
to which the practice of selling goods
on installment has grown in late years,
especially in the larger towns and
cities.

It is characteristic of the average
wage earner that the earning and get-
ting of money are much easier than the
saving of it. Thus one of the greatest
obstacles to the adoption of the cash
system in trade has been the difficulty
of educating purchasers to save enough
money to pay for their purchases wken
made. It seemed necessary to use the
moral influence of the debtor’s obliga-
tion to enable such to devote their earn-
ings. to the proper purchase of family
necessities, or to the addition of such
luxuries and permanent improvements
as are conducive to the refinement and
material advancement of the family.
Considerable progress had been made
in this education when it began to be
largely interfered with by the Cemoral-
izing influences of the installment  sys-
tem.

The possibility of the development
of this system depends on the same im-
provident characteristics which made
the credit system so persistent—in fact,
it is the credit system, with all its ob-
jectionable features, except that with
the organized methods of collection
there is less of the probability of final
loss; and there may be value in the sal-
utary influence of showing the pur-
chaser that he can pay when he is
obliged to do so.

But, whatever benefit there may be of
this character, it is much more than
counterbalanced by its disadvantages.
Among the greatest of these, from the
business standpoint, is the interference
with legitimate trade in the securing
of an advance lien on the wage earner’s
work. Regular dealers are beginning
to realize, from the greatly diminished
trade capacity of their customers, to
what an extent this system has grown,
and in self-defense too many have been
obliged to contribute to the growth of
the evil by joining the ranks of the in-
stallment dealers; and through such
means much of the advantage gained
in the fight against credits has been
lost.

One of the greatest objections to the
old credit system was the enhanced cost
of commodities, resulting from the ne-
cessity of adding losses and cost of col-
lection to the expenses of the business,
to be borne from increased ratio of ap-
parent profit. This consideration was
one of the most potent influences in
securing the partial abolition of the
system which has begun toobtain. But
this advantage is likely to be inore
than sacrificed through the insidious
growth of installment trade. Already
there is a vast army of collectors to be
supported from the profit account. This
has increased the cost of the installment
goods, and lessened capacity for buying
at regular stores has increased the nec-
essary ratio of profit, so that it has_ re-
sulted in an increase all around. It is
a fact which any installment dealer
will corroborate, that the goods sold on
that system cannot be purchased a

 

cheaper for cash. The gradual growth
of the system and of the organization
of the methods of collection has caused
an adjustment to the new conditions
which has made the increase of cost
imperceptible.

When an organization is directed to
the pursuit of any kind of work it is
desirable that it be occupied to its ca-
pacity. Thus, under ordinary circum-
stances, the addition of collection ac-
counts in the field already covered is
not a direct increase of cost, and it is
to the advantage of the system that its
work be as extended as possible. The
accession of a family to the installment
list, especially if it be one of some
prestige in its locality, is of sufficient
value to more than pay for its propor-
tion of the average cost of the whole.
So that, when the dealer says he pre-
fers the account to the cash, he means
what he says.

Only those who are in a position to
know realize to what an extent general
trade suffers from the encroachments of
this system. The amount of the pur-
chase, when divided by the number of
payments, seems so small to the thrift-
less consumer that thé trade is consum-
mated without trouble, which would be
impossible if the lump sum were con-
sidered. Solicitors are watching to
keep as heavy amortgage on the
proceeds of the laborer, the salary of
the artisan, or even the revenue of the
professional man or officials, for such
are not exempt from its influence, as
the circumstances will permit, and,
when accessions are gained to (the list,
care is taken to keep them in tribute as
long as possible.

The growth of the installment system
is phenomenal. In cities it is almost
monopclizing some lines of trade.
Furniture, musical instruments, pic-
tures, books are made to appear easy of
acquisition by the seductive smallness
of the payment, and the proportion of
those who pay cash for these and sim-
ilar articles is small.

A curious feature of the installment
idea is the manner in which it has been
taken up by many of the leading news-
papers. Some of these have built up
and carried on an immense business,
especially in pictures and books, which
has been possible only because the ap-
parent cost is made to appear small by
division. Lately, this has developed to
a greater degree than ever in the sale
of cheap reprints of encyclopedias and
similar works. It is a pertinent ques-
tion whether such papers are worthy of
the patronage of the trade public with
which they are thus striving to enter
into competition in the most objection-
able manner. W. N. FULLER.

ie a
The Fool Food Commissioner.
From the New York Merchants’ Review.

Most people will agree with the gro-
cers of Jackson, Mich., in the opinion
that the State Food Commissioner of
Michigan ought to be able to find suffi-
cient occupation looking after the per-
sons who make and sell adulterated
food products, without going outside
his legitimate province and attacking
food products which are not claimed to
be adulterated. Still, very few people
familiar with the vagaries of the aver-
age newly-appointed food commissioner
will be surprised at the Michigan
official’s action in trying to injure the
sale of a certain article, because, in his
opinion. it was sold on too large a mar-
gin of profit. The average food com-
missioner considers himself a ‘‘bigger
man’’ than the Governor of his State,
and acts accordingly.

Men who have succeeded always de-
sire to see the men they employ make
successes.

yeuvvvvevvevevvvvvvevvvvvvvvvvvvyvvuvvyvvyyvyvyvvvvyvyyvyVvYvVwWYS
eee CVC CCC CCC CCC TC TCV CCC CCC CCC CCU CCC UMC CCC OU

It is Enough to Make a

 

 

 

 

Horse Laugh

 

To see how some merchants persist in hanging to the pass
book and other antiquated charging systems when the
adoption of the Coupon Book System would curtail their
losses, lessen the time devoted to credit transactions, enable
them to avoid the annoyances incident to credit dealings
and place their business on practically a cash basis. We
were the originators, and original introducers of the Coupon
Book System—beginning their manufacture at Big Rapids,
Mich., in 1875—-and our capacity is larger than that of all
other manufacturers combined. Over 25,000 retail mer-
chants are now using our books. We want as many more
customers. We want you. Are you willing to receive cata-
logue and price list? A postal card will bring them.

TRADESMAN COMPANY,

Grand Rapids, Mich.

hpbihbp hb hb hbhbhbbhbbhbbbhbbbbob tb throb bobo bbb bbbobh bbb a
GRUGUGVVGUV GOV OV VOU OV OV VV OVO EVO VOU VOGT

Db hha bbb bbh hhh h bh bb & b br br bn br br br br br br bn bn be bn bn bo, bn tn bn bn bn bn bn bp, bn bn lr lh bh br tbh bh hhh bo ho oo GOQOoOoOooo & &
POD GO VO VOSS GV GF FGF FF FOF FG GF FFF FFF OIF IOI
nbn bb 41 411 414} |} |} 4h hh fb bh be bb b> hn br bn br by by hh oO & HOOOSSSOSO}S}OOOSOS SO} OOOOOOO
GDOODOODODS GOV OOGODS GS SF GOV OG GGG FUG V GIG FF FO FF FOO OO

 

 

 

 

 

S
The Best Starch a

SS one eye

wae ; pn
eC cor orien
MAnuFACTUREDONLY BY

ANU URE T eaae

OTe Be VA eee

The Only Starch with Bluing in It .

Requires No Cooking. ate

We are Agents for Western Michigan, and until March s
First will give ee

25-5C PACKAGES FREE Bie

 

WITH EACH CASE.

| M.Glark Grocery Go.
=

is
SL ate ata ans taad nese Ce CE SINE

-
te EE el RENE IS

 

 

 

 

 

 

 

enone,

THE MICHIGAN TRADESMAN

ae

 

 

Commercial Travelers
Michigan Knights of the Grip.
President, S. E. Symons, Saginaw; Secretary,
Gro. F. Owren, Grand Rapids; Treasurer, J. J.

Frost, Lansing.
Michigan Commercial Travelers’ Association.

President, J. F. Cooper, Detroit; Secretary fand
Treasurer, D. Morris, Detroit.

 

Gripsack Brigade.

Some of the best informed men in
the country are found in the rank and
file of commercial travelers.

Jas. A. Massie, who recently submit-
ted to an operation at Butterworth Hos-
pital, is gradually improving and will
soon be out again.

Traveling men selling *‘bikes’’ have
organized a social association of their
own to be known as the Cycle Travel-
ers’ Association of America.

The commercial traveler is a_ repre-
sentative of a class engaged in the work
of pushing a good thing; the harder he
pushes the larger salary he is liable to
earn.

The ambassador of commerce isa firm
believer in the inalienable right to kick
and to kick hard. He has no sympathy
for the man who will bear insult or
abuse without demurring.

The Detroit Traveling Men’s Base
Ball Club has been organized for the
season of 1806 by the election of E. W.
Reynolds as Captain and W. H. Baier
as Secretary, Treasurer and Manager.

W. D. Huff, formerly a resident of
this city, but for the past nine years a
citizen of Burlington, Vt., has returned
to Grand Rapids and taken the position
of Michigan salesman for the Worcester
Salt Co., of N. Y.

The rascally merchant always hesi-
tates to make a statement to the travel-
ing representative. He should bear in
mind that the salesman has a right to
know something about his business
affairs in order to know about his abil-
ity and intention to pay for what he
purchases.

Fred L. Anderson, traveling repre-
sentative for the Rodgers Boot and Shce
Co., of Toledo, recently purchased the
A. R. Morgan shoe stock, at Mar-
quette, of A. C. McGraw & Co., resell-
ing the stock the next day toa Mr.
Goodspeed at a handsome margin. The
inventory value of the stock was $7,000.

The social party to be given by Post
E at Imperial hall Saturday evening
promises to be one of the most enjoy-
able events ever conducted by Grand
Rapids traveling men. Both dancing
and progressive pedro will be on tap,
while those who neither dance nor play
cards can tend door or pass the water

pitcher. None but traveling men need
apply.
Frank E. Chase, who traveled in

Western Michigan seventeen years for
the former firm of A. C. McGraw &
Co., but who has represented the Brad-
ley & Metcalf Co. (Milwaukee) for the
past four months, bas transferred his al-
legiance to Baldwin, McGraw & Co., of
Detroit. The change dates from March
1, but the matter of territory has not
yet been fully decided upon. Frank
says this is the last change he proposes
to make—until he can better himself
again.

The man who goes on the road with
the idea that he must cut prices in or-
der to effect sales makes a great mis-
take, for he chains himself before he
begins work and starts out on a false
basis. He should start out filled with
the belief in his own strength, the hon-
esty of his price list and by solid per-

 

sonality ask and get what he starts for
if he desires to make a successful com-
mercial traveler. It 1s personality and
skill in handling a customer that win
every time and the manner which con-
vinces your listener that you believe
every word you say. That's what tells.
The Queen's hotel, Montreal, bas de-
cided upon adopting an improvement
in the hotel which will be a decided in-
novation in Montreal. It is a special
room for commercial travelers, and is
not to be confounded with anything in
the way of ordinary sample rooms. In
the proposed accommodation, the com-
mercial men will be entirely by them-
selves and separated from the other
hotel guests. They will have their own
dining room and_ their own waiters.
The dining room after meals will, also,
serve as a general smoking and _ loung-
ing room, where the commercial guests
may receive their friends. This idea
has long been in favor in England,
where it has been carried out with suc-
cess by some of the best hotels.
—_—___—»> 2 >—___—
Lake Shore Must Issue Family Mileage.
As the recent decision of Judge Lane,
at Adrian, is of vital interest to travel-
ing men, the Tradesman has taken the
trouble to secure a brief of the opinion,
as follows:

Ths case came before the court upon
the petition of relator, a married man,
for a peremptory order compelling re-
spondent to issue to him a thousand-
mile ticket good for two years for him-
self and wife, basing his claim upon
the amendment to sub-section nine, of
section uine of the general railroad
law of Michigan, which provides that
tickets of the kind demanded _ shall be
kept on sale at the principal ticket
offices of all railroad companies oper-
ating lines of railroad in Michigan.

The opposition to the order was made
upon two principal grounds: 1. Re-
spondent is exempt from the provisions
of this law by virtue of its charter. 2.
The law is unconstitutional, being out-
side the pale of legitimate governmen-
tal control and providing for the taking
of property without just compensation,

Respondent is the product of the con-
solidations of domestic with foreign
corporations, one of which consolida-
tions was of the old Michigan Southern
Railroad Company with the Northern
Indiana Railroad Company under an
act granting to the new company all the
powers and franchises of the old com-
panies. This new company was in
turn consolidated with several other
foreign corporations under the name
borne by respondent. This occurred in
1869. This last consolidation was by
virtue of the provisions of the general
railroad law of the State before that
time enacted.

The contention of relator was that re-
spondent was operating its lines in
Michigan under the general law of the
State, while that of respondent was that
it was operating such lines under the
old Michigan Southern charter, which
gave right to fix rates for transportation
ad libitum.

The court holds that, when respondent
accepted the benefits and _ privileges
conferred by the general law when it
came into existence, it became a new
corporation with a new charter; that it
took this life at the expense of the con-
stituent companies, which became ex-
tinct with the creation of the new; that,
being so far as Michigan is concerned
a creature of the general law, it is sub-
ject to its provisions, and hence to its
regulations of rates of tolls to be
charged.

Upon the other question the court fol-
lows the policy of circuit courts gen-
erally and does not pass upon the con-
stitutionality of the law as being a sub-
ject more properly for courts of iast re-
sort, but hints that, if it were called up-
on to decide this question, it would hold
against the law as being a usurpation
a control over the business affairs of
the company not within the control of

 

the State upon any principle which per-
mits the exercise of police power of the
State over railroad companies, which is
usually assumed upon the theory of pro-
tection of the public from injury through
accident occasioned by faulty construc-
tion of its line or equipment or from
faulty rules for the moving of its trains,
as well as protection of the public from
the fixing of extortionate rates of toll.
The attorneys for the Lake Shore an-
nounce that they will take an appeal to
the Supreme Court, and, in case that
tribunal decides adversely, they will
carry the matter to the Federal Supreme

Court.
—_< 0.

Kepler Patent Good and Valid—Stimp-
son Does Not Infringe.

At a session of the Circuit Court of
the United States for the Eastern Dis-
trict of Michigan, continued and _ held,
pursuant to adjournment, at the District
Court room, in the city of Detroit, on
the ninth day of March, in the year one
thousand eight hundred and ninety-six.

Present, the Honorable Henry H.
Swan, District Judge.

The Computing Scale Co., Com-
plainant, vs. The Stimpson Computing
Scale Co.. Defendant.

In Equity.

No. 3465.

This cause coming on for hearing on

this day, by consent of counsel for the |

respective parties, it 1s ordered, ad-
judged and decreed :

That the Kepler patent No. 514,475 Is
a good and valid patent.

That the Stimpson Computing Scale,
having two sets of computations, one
on the computation plate and one on
the poise as manufactured and sold by
the defendant, is not an infringement of
said patent. i

That the complainant’s bill be dis-
missed with costs.

a ——

It has been considered that American
interests and investments in Cuba con-
stitute a serious obstacle to the cause of
independence; that, in the event of the
revolution’s proving successful, the
Spanish government would not be liable
for damages to American property. But
it is becoming a question whether the
long continuation of the war is not pro-
ducing conditions making it for the
best interests of American investors that
the Cubans should succeed. In the case
of Spanish success, the Island will be
loaded with so great a debt that it must
result in practical bankruptcy, destroy-
ing the values of investments in’a way
for which Spain will not be financially
responsible. Then American trade will
needs suffer from the high tariff made
necessary by this debt. It is probable
that the matter has already passed the
point where it would be for the selfish
interest of a majority of Cuban _ invest-
ors that Spain should succeed.

 

Saws, Files,
Speed Indicators,
Lace Leathers,

How Storrs is Regarded at a Distance.

New York Merchants’ Review: The
height of absurdity appears to have

been reached by the Food Commission-
er of Michigan in
prosecutions of dealers.

some of his recent
Indeed, he
fel-
low commissioners in other states, ridic-
ulous as these have been, completely
out of sight.

Philadelphia Grocery World: The
Pure Food Commissioner of Michigan
seems to be a rather peculiar individ-
ual, even more so than Commissioner
McNeal of Ohio. In a recent report
upon a case, while he made no charge
of impurity, he made a lengthy argu-
ment attempting to show that the profit
derived by the manufacturer was far
larger than was justified. This un-
called-for interference with concerns
which were none of his affairs raised a
great hue and cry all over the State,
and the Commissioner has since been
forced to apologize. This is an evi-
dence of the great care necessary in ap-
pointing the enforcers of a law which
is likely to be more or less unpopular.
Upon the official who is to enforce such
an act will depend to a great extent the
ease or difficulty with which its pro-
visions will be carried out.

> 2. -
Smoke the Dodge Club Cigar.

seems to have left the antics of his

 

Cutler House in New Hands.

H. D. and F. H. Irish, formerly landlords at
the New Livingston Hotel, at Grand Rapids,
have leased the Cutler House, at Grand Haven,
where they bespeak the cordial co-operation
aud support of the traveling public. They will
conduct the Cutler House as a strictly first-class
house, giving every detail painstaking  at-
tention.

Bridge Street
... fF 10USE...

Corner of Bridge and
Kent_Streets,

Grand Rapids, [lich.
Rates $1 and $1.25 per day.

Best House in the State
for the [loney.

E. FULLERTON & CO., Props.

Pie 2000@
2s a 1)
©

 

 

   
  
     
       

 

 

SELL THESE

CIGARS

and give customers good
satisfaction.
DOOOOOQOOOQOOOOS

 

Emery Wheels,
Steam Gauges,
Belts, Hooks, Waste,

Lubricating Oils,

Leather and Rubber Belting

Cotton and Chain Belting, Asbestos, and
all other kinds of Pipe Covering

st

Call on us, for we are headquarters
for all kinds of Mill Supplies.

Studley & Barclay,

4 Monroe Street,

Grand Rapids.

 

13

THE MICHIGAN TRADESMAN

 

 

Drugs--Chemicals

STATE BOARD OF PHARMACY.
C. A. BueBEE, Charlevoix
Two Years— S. E. PARKILL, Owosso
Three Years— - F. W. R. Perry, Detroit
Four Years— - A.C. ScHuMAcHER, Ann Arbor
Five Years— - - Gro. GuNDRUM, lonia
President, C. A. BUGBEE, Charlevoix.
Secretary, F. W. R. Perry, Detroit.
Treasurer, GEO. GuNDRUM, Ionia.
“‘oming Meetings—Grand Rapids, March 3 and 4.
Detroit (Star Island), June 23.
Lansing, November 3.

MICHIGAN STATE PHARMACEUTICAL
ASSOCIATION.

President, Geo. J. Warp, St. Clair.

 

One Year— -

- ; (S. P. WuirmarsnH, Palmyra;
Vice-Presidents 7G. C. Pamures, Armada.
Secretary, B. ScoroupER, Grand Ra pids.
Treasurer, WM. Dupont, Detroit. ;

Executive Committee—F. J. Wurzpure, Grand
Rapids; F. D. STEvENs, Detroit; H. G. COLMAN,
Kalamazoo: E. T. WEBB, Jackson; D. M. Rus-
SELL, Grand Rapids.

The Drug Market.

Acetanilid—A continued quiet mar-
ket is reported with quotations nomi-
nally steady.

Acids—There are no further changes
to note in quotations of any description,
and with a fair jobbing movement of
leading varieties, the tone of the gen-
eral market is steady.

Alcohol—Grain is finding a steady
consuming outlet at unchanged prices,
which are maintained. Wood continues
to move fairly with values firm.

Arsenic—Foreign advices report con-
tinued scarcity of powdered white and
values here are firmly maintained.

Atwood’s Bitters have advanced to
$1.75 per dozen.

Balsams—Copaiba has met with a
good consuming inquiry and a fair av-
erage business is reported in Central
American at prices within the old range.
Peru is quiet and nominally steady.
Canada fir in limited jobbing request.

Beans—The market for tonka remains
quiet but values are steady. Mexican
vanilla are moving freely in a jobbing
way, with holders decidedly firm in
their views.

Cacao Butter—The demand has im-
proved, but prices are a shade easier.

Cassia Buds—The market
quiet with values steady.

remains

Cocaine—On Tuesday last manufac-
turers issued circulars announcing a re-
duction of 25 cents per oz. The easier
feeling is attributed to lower crude ma-
terial in foreign markets.

Cod Liver Oil—The outlook abroad
has continued to indicate a very small
yield from the current season's catch
and the influence on values is shown by
a very marked advance during the
past week. It is generally believed that
the shortage this year will be greater
than that of 1895. An unusually heavy
business is reported, the sales of desir-
able grades approximating over 400
barrels, the bulk of which is supposed
to have been purchased for account of a
large manufacturing consumer, and _ for
part of the lot as high as $60 was _ paid.
Most of the stock of reliable oil now in
the market is under close control and
holders offer only sparingly at $62@65
as to brand and seller. There is some
inquiry from London and Hamburg for
choice grades, which may result in busi-
ness and further deplete the available
stock. The stock of Newfoundland oil
is practically exhausted, all desirable
parcels having been quietly bought up
and shipped abroad.

Colocynth Apples—Continue in limit-
ed request and steady.

Cream Tartar—Is unchanged and
without new feature, the consuming de-
mand continuing moderate.

sympathy with the berries.

 

Cubeb Berries—A _ continued tame
market is reported with values easier.

Cuttle Fish Bone-—Is active and firm.

Essential Oils—Anise is quiet but
steady. Cassia has declined owing to
lack of demand, together with an easier
feeling abroad and lower offers from
foreign holders. Cubeb is easier, in
There has
been some business in H. G. H. pep-
permint for export.

Flowers—The only article of special
interest in this department is saffron.
Spanish is stronger. American has de-
veloped increased activity and consid-
erable sales by the principal holder are
reported. A large shipment of new crop
is due by next steamer, which will be
the earliest arrival on record. Other
parcels are to follow on same _ contract.

Glycerin—Is moving fairly on orders
from the consuming trade with prices

unchanged and firm.
Gums—Asafetida continues active
without change in prices. Camphor

maintains its strong position.

Leaves—Short buchu are active with
prime quality scarce, but former quo-
tations are yet current. All varieties of
senna are tending upward owing to an
advance of 10@15 per cent. at the last
London sales, and indications point to
a further rise. The last crop was of
average proportions, but the demand
has been unusually heavy and holders
are consequently firm in their views.

Maltine with Cod Liver oil has ad-
vanced to $9 per dozen. Maltine with
phosphate, iron, quinine and strychnine
and Maltine with Peptone have both de-
clined to $9 per dozen.

Manna—Continues to meet with a
moderate jobbing inquiry with quota-
tions steady.

Menthol—Is quiet and nominal.

Morphine—The market is without
new feature and quiet with quotations
based on the old range.

Opium—Values have continued to
rule in buyers’ favor, but no business
of consequence has transpired during
the current week.

Quicksilver—A moderate business is
reported.

Quinine—Is unchanged and in fair
request for consumption.

Potash, Cyanide—The market is easier
and manufacturers have reduced the
quotation of C. P. in bulk. The de-
cline is attributed to the lower figures
for yellow prussiate of potash.

Roots—Ipecac is meeting with a good
seasonable demand and prices are firm.
Jalap continues weak and demoralized
with jobbing prices showing a further
decline. Jamaica ginger is scarce on
the spot, arrivals of new crop continu-
ing of undesirable quality. Mexican
sarsaparilla is very dull. Gentian con-
tinues firm.

Seeds—Only a hand-to-mouth business
is reported in the various kinds of
canary and the market has ruled tame
with quotations nominally unchanged.
Dutch caraway continues steady, but
only small lots are moving; the Am-
sterdam, from Rotterdam, brought 200
bags. Russian hemp is very firm.
German rape has sold to the extent of
about 100 bags ata slight concession,
but a firmer tone has since prevailed.
All varieties of mustard have received
more or less attention and a good _busi-
ness is reported in California Trieste
and Sicily brown, both of which are
firm in price, the former being very
scarce. California yellow is offering
freely from the Pacific Coast, but there
is no demand of consequence for that
variety andthe feeling is easier with

 

values fractionally lower. Poppy con-
tinues easy under the influence noted
in our last issue and values have further
declined. There has been a marked in-
crease of demand for celery and the
bulk of recent orders have been filled
by out-of-town holders. The spot mar-
ket is said to be about cleared of out-
side lots, with the tendency upward.
Coriander is weak. Shelled cardamons
have been further advanced.

Spermaceti—A continued quiet mar-
ket is reported, with only small orders
coming to hand and quotations for block
have been reduced.

Sugar of Milk—The demand has con-
tinued active, and with an abundant
available supply, sales are freely made.

—__§_»0.___
Carried Away With Science.

A well-known Bohemian visited his

friend, Prof. Price, at the latter’s lab-

oratory. The professor was examining
a dark-brown substance spread on
paper.

‘*T say, would you kindly let me place
a little bit of this on your tongue? My
taste nas become so vitiated by tasting
all sorts of things. ’’

Certainly,’’ responded the ever ac-
commodating Harris, thrusting out his
tongue.

The professor took up a little ot the
substance under analysis and placed it
on Harris’ tongue. The latter worked
it ’round for fully a minute, tasting it
much as he would a fine confection.

‘*Note any effect?’’ inquired the pro-
fessor.

‘No, none.’’

‘*It doesn’t paralyze or prick your
tongue?’’

‘*Not that I can detect.”’

‘*I thought not. There is no alkaloid
in it, then. How does it taste?”’

‘Bitter as the dickens?’’

‘*‘Um-m; all right.’”’

‘*What is it?’’ inquired Harris.

‘‘T don't know. That’s what I’m
trying to find out. Some one has_ been
poisoning horses with it.’’

a
Advantage of a Mechanical Education.

Among the seven trades which a
student in mechanical engineering must
learn at Cornell University is that of the
blacksmith. Occasionally there is a
protest, but it is never heeded. One
dude, ten years ago, was unusually
averse to soiling his hands, but he had
to work at the forge just the same.
Last fall he went to Professor Morris
and thanked him for being compelled
to learn blacksmithing. *‘Why?’’ asked
the professor. ‘‘Why, you see,’’ replied
the former dude, ‘‘I am now superin-
tendent of a mine in Colorado. Last
summer our main shaft broke, and there
was no one in the mine but myself who
could weld it. I didn’t like the job,
but I took off my coat and welded that
shaft. It wasn’t a pretty job, but she’s
running now. If I couldn’t have done
it, I'd have had to pack tiat shaft on
mule back and send it 300 miles over
the mountains to be fixed, and the

 

mine would have shut down until it got
back. My ability to mend that shaft
raised me_ in the eyes of every man in
the mine, and the manager raised my

salary.’’
—-—~> 6 >

Smoke the Dodge Club Cigar.

 

 

a...

Southern - Pacific

Celebrated ‘‘Sunset Limited ’’ Transcontinental
train service

BETWEEN
NEW ORLEANS,
LOS ANGELES and
SAN FRANCISCO

Is Unsurpassed
And the new equipment of these magnificent
trains excels in elegance and comfort the superb
service of the past season.

58 hours New Orleans to Los Angeles.

 

7 5 hours New Orleans to San Francisco.

 

Direct connection from all points in Michigan
is made by leaving Chicago Saturday and Tues-
day nights (or Wednesday at 3 a m.) in
through sleepers with

Sunset Limited Trains

Comprising: Composite Cars—Including bath-
room, barber shop, cafe, library and smoking-
100M ;

Sleepers—Double drawing-room and 10 sections,
also combined compartment and Ladies’ Par-
lor Car, rivaling in perfection of detail all
former achievements of car building on the
— especially designed for lady trav-
elers;

Diners—Meals served alacarte. The entire
train illuminated with Pintsch Gas.

Leaving New Orleans Semi-Weekly,
MONDAYS AND THURSDAYS.

THE SUNSET ROUTE

is the first line in the United States to recognize
that heretofore accommodations for lady trav-
elers have been inadequate to the requirements.
The ladies are more especially taken care of
than in any cars heretofore built. Instead of
being compelled to sit up all day in the ‘“‘cubby”’
seat of a sleeper. while the liege lords may per-
ambulate the train and gather in a special com-
partment to talk, smoke, etc., one end of the
boudoir and drawing-room car accompanying
each train is to have a special room fitted up for
the ladies. with library, the latest magazines and
periodicals, reclining couches and other needed
comforts. These cars are sixty-nine feet in
length and have seven boudoir sleeping com-
partments, each with s-parate entrance and ca-
pable of being thrown en suite. Each compart-
ment has two sleeping berths, a washstand and
the necessary lavatory fittings, and opens onto a
hallway on one side of the car. A ladies’ maid
accompanies each train for the accommodation
of lady passengers, more particularly for those
traveling without escort. The train is also
accompanied through from starting point to
destination by an experienced and courteous
representative of the Passenger Department,
who acts as @ personal escort.

For information concerning California, time
tables, rates of passage and any particulars re-
garding the journey to California, address

W. G. NEIMYER,
Gen. Western Agt Sou. Pac. Co.,
S. F. B. MORSE, 230 Clark St., Chicago.
G. P. & T. A. Sou. Pac. Co.,
New Orleans, La.

PECK’

Pay the Best Profit.

 

HEADACHE..........
seseeeseeees POWDERS

Order from your jobber

 

 

 

GSYPSING

Practical Plaster Paris Wall Finish.

The only Permanant Finish that does not set or

settle in the dish.

Ready for Use by adding Warm Water.
Equally well adapted to Plain Tinting or the heaviest
Relief Work. Well Advertised. Well Known.

MADE ONLY BY

DIAMOND WALL FINISH CO.
Grand Rapids, Mich.

 

 

 

4
i
t
€
:
:

 

 

wnsevetsit
[mee

Mb biNN te.

 

 

:
§
4

s
3
:

 

 

asnsev aaron
—

Mi satan

 

THE MICHIGAN TRADESMAN

 

 

WHOLESALE PRICE CURRENT.

 

Advanced—Nitrite Silver, Arsenic.

 

Declined —Oil Cassia.

 

 

 

 

 

Acidum
Aeceticum........-..-. $ S@s 10
Benzoicum, German 7@ 80
ee @ 15
Carbolicum ......... BQ 37
oo  ............ uMq@ 4
Hydrochlor ......... 3@ 5
INitrocum ..........- 8@ = 10
Oxalicum......:...-. «a 2
Phosphorium, dil. @ tb
Salicylicum. ........ 55@ 65
Sulphuricum. <.- ioe 5
Wenmictm .......... 1 40a, 1 60
Tartaricum.......... Bua «40

Ammonia
Aqua, 16 deg........ 4@, 6
hae an Gee... 6@, 8
@Garbonas........... 12@ 14
Chloridum .........- 12@ 14

Aniline
Bisek . ... 1.2... 2@0@ 22
Brows .............- 80@, 1 00
Bog .. 2... . 45@ 50
Yellow. .....-:....-- 2 50@ 3 00

Baccz.
Cubezsee.......- po.18 B@ 15
duniperus..........- 6@ 8
Xanthoxylum.. .... 3@ 30

Balsamum

_ ..........., 45@ 50
— = "aca
Terabin, Canada. 40@ 45
Tolutan.........- 75@ 80

am
Abies, Canadian.... 18
angie .. 2.5005... 12
Cinchona Flava..... 18
Euonymus atropurp 30
Myrica Cerifera, po. 2)
Prunus Virgini...... 12
Quillaia, gr’d....... 10
Sassarras........-..-- 12
Ulmus...po. 15, gr’d 15
Extractum

Glycyrrhiza Glabra. 4@ 2
Glycyrrhiza, po..... 28, 30
Hematox,15lbbox. H@ 12
Hematox,is........ 13@ 14
Hematox, 4S.....-- M@ 15
Heematox, 148.....-. 6@ %

Ferru
Carbonate Precip.. 15
Citrate and Quinia.. 2
Citrate Soluble...... 80
Ferrocyanidum Sol. 50
Solut. Chloride..... 15
Sulphate, com’l..... 2
Sulphate, com’l, by i

bbl, per cwt....... 35
sulphate, pure ..... 7
Flora
Ayes ..-....-.....- 12@ 14
Amthemis......-.-.- 18@ 25
Matricaria .........- 18@ 2%
Folia
Barosma........----- 200@ 30
Cassia , Acutifol, Tin- i

nevelly...... --.-- 18@, 25
Cassia Acutifol,Alx. 25@ 30
Salvia officinalis, } ws i

wi 368... oe es 12@ 20
Ure Urei........... .- 10

Gummi
Acacia, Ist picked.. @ 60
Acacia, 2d picked.. @ 40
‘Acacia, 3d picked.. @ 30
Acacia, sifted sorts. @ Ww
Acacia, po..........- 60@ 80
Aloe, Barb. po.20@28 MH@ 18
Aloe, Cape ....po. 15 @ 12
Aloe, Socotri. -po.40  @ 30
Ammoniac.......... 55@ 60
Assafeetida....po.30 22@ 2%
Benzoinum ......... 50@ 55
Catoehu, is.........- @ 13
@atechnu, 45.......-.. @ 14
Catechu, as psoas __@ 16
Camphore 6G 68
Euphorbium. “po. 35 @ 10
Galbanum........-.- @ 1 00
Gamboge po........ 65@, 70
Guaiacum..... po. 35 @ : 35
Kino... ...:.. po. $3.00 @ 3 00
— ee eee @ 6
Myrrh. ........ @ 40
oa -po. $3. i330 30 2 220G 2%
Shellac cc 40@ 60
Shellac, bleached... 40@ 45
Tragacanth ......... 50@ 80

Herba
Absinthium..oz. pkg 25
Eupatorium .oz. pkg 20
Lobelia...... oz. pkg 25
Majorum ....0z. pkg 28
Mentha Pip. .0z. pkg 23
Mentha Vir..oz. pkg 25
ee sc oz. pkg 39
TanacetumV oz. pkg 22
Thymus, V..oz. pkg 25

Magnesia.
Caleined, Pat..... .. 55@ 60
Carbonate, Pat...... 20@ 22
Carbonate, K.&M.. 20@ 2%
Carbonate, Jennings 35@ 36

Oleum
Absinthium......... 3 25@ 3 50
Amygdale, Dule.... 30@ 50

Amygdale, Amare . = s 8 25

 

CS 10@ 3 20
Auranti Cortex..... 3 30@ 2 40
Bergamii...........- 3 00@ 3 20
Gailp = Se i =
aryophylli......... 7
Coane. ee eee eee 33@ _ 65
Chenopadii.......... @ 2 50
Cinnamonii. ........ 2 50@ 2 60
Citronella. .... .... @ 80

 

  

 

 

 

Conium Mac........ 35@,
Copaipa...... ...... 80@,
Cubebe.............. 1 50@
Exechthitos ........ 1 20@
Erigeron ... | Eee
COMItheris ..... .... 1 50@
Geranium, ounce... @
Gossippii,Sem. gal.. 50@
Hedeoma..... ...... 1 5@
Jgunipera............ 1 3O@
Lavenduia......_... 90@,
Linon. ........... | ae
Mentha Piper. es 2 B@
Mentha Verid....... 2 F@
Morrhue, gal....... 2 00@
Myrcia, ounce....... @
Clive Ta
Picis Liquida. . 10@
Picis Liquida, gal... @
Rema I1@
Hosmarini.......... @
Rost, oumce........ 6 50@
Sucem: ..........
Sabina . 90,
o.).............. 2 aoe
Sassarras.......-.... 50@,
Sinapis, ess., ounce. @,
Cee @
Wine ... _... 40@,
Thyme, Ope. 2 @
Theobromas........ 1X@
Potassium
BEBarp. -..... a
Bichromate ........ 13@,
— eee ee 15@,
BOT 12@,
aaa. -po.17@19e  =16@
Cyanide.. _... se
fodide 000001.) Sioeg
Potassa, Bitart, pure 32@
Potassa, Bitart, com @
Potass Nitras, opt... 8@,
Potass Nitras........ "@
Prassiate ... 1... 2a,
Sulphate po .. ..... 15@
Radix
AGonitvey...... 2... 20@,
Aithe 8 .. 2@
a 12@
Are pe... @
Calamus ....... 20@,
Gentiana...... po ‘1 R@
Glychrrhiza...pv.15 16@
Hydrastis Canaden . @
Hydrastis Can., po.. @
Hellebore, Alba, ioe 15@
Inula, po. . 156@
Ipecac, po.. 1 65@
Iris plox. Nea po35@ 38 35@,
Jalapa, or eee eles 40,
Maranta, 145........ @
Podophyllum, po.. 15@,
mer @
Riel emt... 6... :. D,
hei py..--__.. _- =o
Spicela. .-... 35@,
Sanguinaria...po. 15 @
Serpentaria......... 2@
NemeeA 55@,
ace ream ena H @
Smilax, — @,
ee... “po. 35 10@,
Symplocarpus, Feeti-

@us, pO... 1... @
Valeriana,Eng.po.30 @
Valeriana, German. 15@,
Minewers........ 12@
Zingiperj. _....._.. 23@

Semen
Anisum....... po. 20 @.
Apium (graveleons) 1l14@
Bird, fs... 4@,
Carut......... po.18 10@
Cardamon.....-..... 1 00@,
Coriandrum......... &@
Cannabis Sativa.... 3%@
Cydoninum........._. TQ,
Chenopodium ...... 10@
Dipterix Odorate... 2 90@
Foniculum ......... @
Foenugreek, po.. 6@.
tL 4@
Lini, grd....bbl.2% 3%@
Eopens ..... .......- ae
Pharlaris Canarian. 3%@
mone “4@
Sinapis Albu........ 7@.
Sinapis Nigra....... 11@

Spiritus
Frumenti, W. D. Co. 2 00@
Frumenti, D. F. R.. 2 00@
Mramenti...... ..-. 23a,
Juniperis Co. O. T.. 1 65@
Juniperis Co........ )

Saacharum N. E....
Spt. Vini Galli......
Vini Oporto.........
Vint Atha... <5...

fake peek beh peed pet pet
wy LE

Sponges
Florida sheeps’ wool
carriage. 2 0@
Nassau sheeps ‘wool
Garriage..<... @
Velvet extra sheeps’
wool, carriage..... @
Extra yellow sheeps’
wool. carriage.... @
Grass sheeps’ wool,
carriage...) 2... @.
Hard, for slate use.. @
Yellow Reef, for
Siate USe..... 2... @
—
Acacia . ee @
Auranti Cortes. ee @
Mingiper....0 0 2. @
Ipecac..........--.. @
Berri log... .... @
Hiei Arom.......... @
Smilax Officinalis... 50@
Seners ......-,... es @
Lo ae @

a

WwW We woo

we

— at et

Who 0509

noo

D>

 

SuSen

_ —_
09 D Ute © He He OO UE

_

SSSSSSESS

 

 

aio |... oa BO
Wolytan............ @ 50
Prunus virg.. -..... @ 50
Tinctures
Aconitum Napellis R 60
Aconitum Napellis F 50
60
Aloes and Myrrh.... 60
ArniCeA oe... 50
Assafcetida ......... 50
Atrope Belladonna. 60
Auranti Cuortex..... 50
a 60
Peusoin Co.......... 50
ParOemia .. 1... .. 50
Cantharides........
Capsicum ....... 50
Cardamon ... . 5
Cardamon Co.... WD
Caseor........ 1 00
Catechn......... 50
Cinehona........... 50
Cinchona Co.... 60
“7s ........... 50
Cubeba. . _- 50
Cassia Acutifol..... 50
Cassia Acutifol Co . 50
—* a . 50
So 50
Ferri Chloridum.. 35
Gentian... ..._._.. 50
Gentian Co.......... 60
“5 ........... 50
Guiaca ammon...... 60
Hyoseyamus........ 50
fodineg..:..c.... vi)
lodine, colorless.... 5
Ming... 50
bopela.. .......... 50
Myrrh. eee 50
Nux Vomica........ 50
On 5
Ovii, camphorated. . 50
Opii, deodorized.... 1 50
Guessta 50
Pe 50
CT 50
Sanguinaria . ...... 50
Serpentaria ........ 50
Stromonium........ 60
Wolutan..... 1... 2... 60
Waleman 50
Veratrum Veride... 50
Zimgeiper............. 20
Miscellaneous

Ether, Spts. Nit. 3 F 35
Ether, Spts. Nit.4 F 31@ 38
as. iC; 24@ 3
Alumen, gro’d..po.7 3@ 4
Anmpatie............ 40@ 50
Antimoni, po.:..... 4@, 5
Antimoniet PotassT 55@ 60
Amtipyrim .......... @ 1 40
Antifeébrin. ..... @ &
Argenti Nitras, Oz. @ os
Arsenicum. eee 10@ 12

Balm Gilead Bud . 38@ 40
Bismuth §. N. -. 12Qina
Caleium Chlor., (tes @ 9
Caleium Chlor., ws. @
Caicium Chlor., 4s. @
Cantharides, Rus. po a @&
Capsici Fructus, af. @
Capsici Fructus, po. @ 1
Capsici FructusB,po @° &
Caryophyllus..po. 15 10@ = 12
Carmine, No. 40..... @z7
Cera Alba,S.&F .. 30@ 5
Cera Fiava.......... 40@, 2
Ceceus. 2... oe @ 40
Cassia Fructus...... @ ma
Centraria........ ... @ WwW
Cetaceum..... ...... @ 45
Chioroform.......... 60@ 63
Chloroform, squibbs @13
Chloral Hyd Crst.... 1 15@ 1 30
Chaos .......... 2@ 2D
Cinchonidine,P.& W 15@ 20
Cinchonidine, Germ sae 12
Cocaine ............ 5 0G 5 25
Corks, list, dis.pr.ct. 65
Creceotum. ......... a
en. bbl. 75 @ 2
Creta, prep. ......... @ 5
Creta, preeip........ es ll
Creta, Rubra... .... @ 8
oo ............. 50@ 55
Oudnpear .......-.... a Aa
Cupri Suiph......... 5@ 6
Dextrine...... . wa
Ether Sulph......... @ 9
Emery, all numbers @ 8
Mmimery, po......-.... @ 6
Breots. .......- po.40 30@ 35
Fiake White........ 12@ 15
-.. ........... @ 2
Gambser............. 8@ 9
Gelatin, Cooper..... @ 60
Gelatin, French..... 30@ 450
Glassware, flint,box 60, 10&10

Less than box.... 6
Gine, brown........ a EF
Glue, wiiite......... LQ BD
Giveerma...... .... 19@ 26
Grana Paradisi .... @ bb
Pumas... ... 8 2@ 55
Hydraag Chlor Mite @
Hydraag Chlor Cor. @ 6
Hydraag Ox Rub’m. @ 8
Hydraag Ammoniati @ &
HydraagUnguentum 45@ 55
Hydrargyrum aes @_ 60
Ichthyobolla, Am... 1 25@ 1 50
oy Os 7x@ 1 00
Iodine, Resubi...... 3 80@ 3 90
Fodoform......_..... @ 4 70
Lupin... @24
Lycopodium ........ 60@ 6
Macig. 6... 6@ 7
Liquor Arsen et Hy-

drare lod... ....._. @ 27
LiquorPotassArsinit 10@ 12
Magnesia, Sulph. 2@ 3
Magnesia, Sulph, ‘bbl @ 1%
Mannia, S. F........ 63
Menthol... ......... @5 0

 

Morphia, 8.P.& W.
Morphia, S.N.Y.Q. &
Cc. Co

Hs ee 1 65@
Moschus Canton.. @
Myristica, No. 1..... 65a
Nux Vomica. .. po.20 @
Os Sepia.. 15@
Pepsin Saac, H. & P.

ee @
Picis Liq. N.N.% gal.
aie. @
Picis Liq., quarts.... @
Picis Liq., pints... .. @
Pil Hydrarg...po. 80 @
Piper Nigra... po. 22 @
Piper Alba....po. 35 @
Pir Burgom........ @
Flumbi Aecet........ 10@,
Pulvis Ipecac et Opii 1 10@
Pyrethrum, boxes H.

‘& P. D. Co., doz.. @
Pyrethrum, Pv Le 27a
Cassa 8@
Quinia, S. P. & W. 37@
Quinia, S. German. 30@.
Quinia, N.Y. 35@,
ee 1 Tinctorum.. 12@

SaccharumLactis Pv 24@
Salaci me 2 0@
ee Draconis. . 40@,
a ee eee 12@

Sapo, zu See ee uous 10@
Sapo. CG . .. @
Siedlitz Mixture.... 200 @

|
1 75@ 2 00 | Sea...

 

  

  

 

i i @ 18 | Lora, Ne.t.......... 40 43
| Sinanis, opt... .... @ 30/ Linseed, pure raw.. 38 40
1 90; Snuff, Maccaboy, De | Linseed, boiled.. 40 42
1 Vee ow, @ 34} Neatsfoot, win ter
80 | Snuff,Scotch, DeVo’s @ 3) stramed........... x
1d | Soda Boras.......... 7 @ 10} Spirits Turpentine. 34 40
18 | Soda Boras, po...... 7 @ ww :
| Soda et Potass Tart. 26@ 28 Paints BBL. LB.
1 O@) Seda, Carh......_._. 14@ 2| Red Venetian...... 1% 2 @8
| Soda, Bi-Carb....... 3@ 5| Ochre, yellow Mars. 1% 2 @#4
2 Oe seas, Ach ......... 3446@ 4} Ochre, yellow Ber.. 1% 2 @3
1 00 Soda, Sulphas...... @ 2| Putty, commercial 244 24%@3
% | Spts. Cologne........ @ 2 @| Putty, strictly pure 2% 2%@3
50 | Spts. Ether Co...... 0a 35| Vermilion, Prime
18 | Spts. Myrcia Dom... @ 2 00 Ame ric anh... . 13@ 5
30 | Spts. Vini Rect. bbl. @ 2 49| Vermilion, E nglish 0@
7 | Spts. Vini Rect.'4bbl @ 2 51] Green, Paris ....... & @ &
12 | Spts. Vini Rect.10gal @ 2 57| Green, Peninsular. 1I3@ 16
1 20} Spts. Vini Rect. 5gal @ 2 50| Lead. Hed....... Q® 5%
Less 5e gal. cash Lead, White... 34
135) 10 days. Whiting, white Sp 70
30 | Strychnia, Crystal... 1 40@ 1 45| Whiting, gilders’. @ 9
1¢@ | Sulphur, Subi....... 2%4@ 3| White, Paris Amer 1 00
42 | Sulphur, Roll. 2@ 2%! Whiting, Paris Eng.
40 | Tamarinds. ____.._- Se 10; cif. @ 1 0
40 | Terebenth Venice.. 28@ 30| Universal Prepared. 1 00@ 1 15
14] Theobrome....... 2@ 4)
20] Vania... 8... 9 00@16 09 | Varnishes
2 60) Ze) Saulph......... I@ 8} No. 1 Tarp Coach... 1 10@ 1 2
50 | | Extea Turp......... 1 60@ 1 70
14 Oils | Coach Body... | 2 75@ 3 00
12 | BBL. GAL. | No. 1 Turp Furn. 1 00@ 1 10
15 | Whale, winter....... 70 70 | Extra Turk Damar.. 1 55@ 1 60
22 | L&ta, CXEFA......... 53 60| Jap. Dryer,No.1Turp 70@ 7%

 

 

AUTPTTPTNTT TPT OTT TTT TTT re reD one reD none eee

Sa TTT TTT

HALELTINE 4
PERKINS
DRUG GU—

Importers and Jobbers of

Dealers in

- DRUGS =

CHEMICALS AND PATENT MEDICINES.

PAINTS, OILS AND VARNISHES

Full line of staple druggists’ sun-

dries.

We are
Weatherly’s
Remedy.

sole proprietors
Michigan

of
Catarrh

We | in stock and offer a full
line of Whiskies, Brandies, Gins,

Wines and Rums.

We sell Liquors for medicinal

purposes only.

We give our personal attention
to mail orders and guarantee satis-

faction.

All orders shipped and invoiced
the same day we receive them

Send a trial order.

HAZELTINE & PERKINS DRUG CO.

GRAND RAPIDS, MICH.

WNALAAAAA AAA AAAAAAAAAAUAAUAAUAAUGAGGAGGU4dUAAA4d

QUAN AAAAahAAGAabLdAAAb dk AA UUkddGUkd ddd dd ddd ddd

Si AlUAUIAJAAUUULULAULANAUAUAU

 

THE MICHIGAN TRADESMAN

 

GROCERY PRICE CURRENT.

The prices quoted in this list are for the trade only, 1
They are prepared just before going to press and are an
possible to give quotations suitable for all conditions of purchase,
erage prices ; for aver age conditions of purchase.

dealers.

those who have
our aim to make this feature of the greatest possible use to dealers

poor credit.

Cash buyers or those o
Subscribers are earnestly ST

in such quantities as are usually purchased by retail
accurate index of the local market.
and those below are given as representing av-
f strong credit usually buy closer than
d to point out any errors or omissions, as it 1S

It is im-

 

 

AXLE —

 

 

« loz. gross
‘io... 6 00 |
a 7 00}
Diamond... ..._. 5 50 |
Frazer's .. fe 9 00 |
IXL Golden, tin boxes % 9 00 |
Mica. = 8 00
Paragon. 6 00

BAKING ‘POWDER.

Absolute. ll

‘4 lb Cams doz...... ----- 45

% lb cans dOz......------- 85

1 Ib eans doz. : 1 50

Acme.

4 ib cans 3 doz.. 45

4 lb cans 3 doz. vb)

.  Wieans (doz. ....-.--- 1 00

Bulk.. __ 10
“Arctic.

‘4 Ib cans 6 doz case .... 5d

My Ib cans 4 doz ¢ a5e  -.._- 1 10

1 Jb eans 2 doz case . 20

5 ibcase 1 doz ease .. _.. 2

JaXon

‘4 lb cans 4 doz case. 45

¢ lb cans 4 doz Case. .... 85
1 lbcans 2 doz case...... 1 60

Home.
M4 lb cans 4 doz case. 35
4 lb eans 4 doz case.....- 5d
1 lbeans 2 doz case. 90
Lynch. i
14 Ib CaMmS..-....----------- 45
et 90
1 beans «bo
Our Leader. i
iq lb cans....---------+ +++: 45

\% lb cans.. i. w3
1 r ib cans.. 1 50

Red ene

ig Ib Cans.....--.---------- 40

ic ib Gams ....-.-.-..--- --
t Means ..--- 1 40

BATH BRICK.

2 dozen in case. i
Asnerteal .......---------=--+-*
Bngligh.........-.-....-------- 80

BLUING.
Gross
Arctic 4 oz ovals.. . 360
Arctic 8 oz ovals. . |e 6 oD
Arctic pints round. oe 9 00
Arctic No. 2 sifting box.... 2 7
Arctic No. 3 sifting box.... 4 00
Arctie No. 5 sifting box.... 8 00
Arctic 1 oz ball.......-.----- 4 50
Mexican liquid 4 0z........ 3 60
Mexican liquid 8 0z......-- 6 80
BROOMS.

No. 1 Carpet.........-------

No. 2 Carpet.......-

ee So

Wet 09 09
S

w
No. 4 Carpet.. 60
Parlor Gem ee 50
Common W nee
Fancy Whisk.. 1 00
Warehouse. 2 50
CANDLES. _
Hotel 40 lb boxes.. 50
Siar 40 ib bokes....._.--....-- 9
Paraftine .. a
CATSUP i
Columbia, pints. .......-_4
Columbia, % pints..........2 50
CEMENT.
Major's, per gross.
4 oz Size....12 00
1 0z size .18 00

2 ox eine...

 

= 2 ozsize

 

lozsize....

Liq. ‘Glue, loz 9 60

Leather Cement,

12 00
18 00

Rubber Cement.

. 2

CHEESE.
piney... @ 12%
a @ 12
, a
ol. a
tiverside.. @ 12%
Gold Medal 12
li... s @ 10
——- |... @ il
Eaam...... i @l
Leiden... @ Bw
Limburger. @ bb
Pascale. @ A
Roquefort........... @ 3
Sap Sago. @ 18
Schweitzer, imported @ 2%
Schweitzer,domestic @ 14

Chicory.
Bulk 5
Red ae 7
CHOCOLATE.
Walter Baker & Co.’s.

a Beers. 2
.. 30

Breakfast eee. oo. 5. s 41

 

 

 

CLOTHES LINES.
Cotton, 40 ft. per doz...
Cotton, 50 ft, per dez.......
Cotton, 60 ft, per doz..-...-

 

Cotton, 70 ft, per doz......- 1 60
Cotton. 80 ft, per doz.......1 80
Jute, 60 ft, per doz......... 80
Jute, 72 ft, per doz.. _—.. so
CLOTHES PINS.
5 gross boxes soo ee)
COFFEE.
Green.

Rio.
Patri oe
Gooa.... 19
Pruec....... 3... ee ee
——...... 21
Peapemy ...

Santos.
ae 19
eee ce 20
Pee 22
Peabo 23

Mexican and Guatamala.

— |... 21
Gesd ok ee
Fepee =. 24
Maracaibo
——— 23
eee 24
Java
Interior. Sect ce. ae
Private Grow a
Moandchtims. 28
Mocha.
pao. 25
or 28
Roasted.
Quaker Mocha and Java... ...32
Toko Mocha and Java........28
State House Blend............25
Package.
oe. lCséCiésC#(CNW(CNi(t‘(#‘(A 18 9
serey ee 18 95
ON 11. PACKAGES. WirHouT GLazING

96 Furr Ounces Nev.

Casts 100 Ibs. tquality Price
60 less 2c per Ib.

Casinets 120 Ibs. Same Price,”

QOf Extra For Capinets.

McLaughliin’s XXXX......15 95
KOFFA-AID.

 

3doz ii case................ 5 &
Extract.
Valley City % gross .....
Felix 4% gross.
Hummel’s foil 44 gross... 85
Hummel’s tin % gross..
COCOA SHELLS.
20 1b bags.. =
Less quantity .. 2
Pound packages. 4
CREASI TARTAR.
Mercy pune. ......
Telfer’s Absolute ......
Greece 2... “ex

 

CONDENSED MILK.

4 doz. in ease.

N. Y¥. Condensed Milk Co.’s
brands.
Gail Borden Eagle.........7 40
newer. ec ee
May 5 75
CHemen .. 4 50
eee... eee
es ee 3 35

 

Peerless evaporuted cream.5 75

compen BOOKS.

  

 

 

‘‘Tradesman.”’
$ 1 books, per 100.....-..... 2 00
$ 2 books, per 100. . 2 50
$ 3 books, per 1) 3 00
# 5 books, per 100.. 3 00
#10 books, per 100... 4 00
#20 books, per 100.......... 5 00
‘*Superior.’’
8 1 books, per 100.......... 2 50
8 2 books, per 100.......... 3 00
$ 3 books, per 100.......... 3 50
$ 5 books. per 100.......... 4 00
$10 books, per 100.......... 5 00
$20 books, per 100.......... 6 00
“Universal.”
$% 1 books, per 100.......... 3 00
# 2 hooks, per 100.......... 3 50
$ 3 books, per 100.......... 4 00
$ 5 books, per 100..... _-- o/00
$10 books, per 100.......... 6 00

$20 books, per 100.......... 7

Above prices on coupon books
are subject to the following
quantity discounts:

200 books or over... 5 per cent
500 books or over...10 per cent
1000 books or over. .20 per cent
Coupon Pass Books,

Can be made to represent any
denomination from $10 wie?

BOeGnS, 0, ces. 00
SObeGkS. 222... 2 00
— hl 3 00
—oo... 6 25
Seepeecs -........ ot 10 00
Se hoeks..-... -..-.------ 17 50

Credit Checks.
500, any one denom’n.....
1000, any one denom’n.....
2000, any one — a...
Steel punch.

Dried Fruits.

DOMESTIC.
Apples.
fmunamed. 2 2. @ 4%
Evaporated 50 lb boxes. @ 6%
California Fruits.
Bxs Bgs

amuw
ae ee

 

 

 

Se .0 @&
B ackberries.. Le
Nectarines .......-....-- . 64@
Poe. 5 @7
Pears. . 8%4@
Pitted Cherries.
Prunnelles..........---.-
Raspberries.........----
California Prunes.
100-120 2 ib boxes....... @ 4%
90-100 25 Ib boxes...-.-- @ 5
80 - 90 25 lb boxes......- @ 5%
70 - 80 25 1b boxes......-. @ 6
60 - 70 25 lb boxes.. .... @ 6%
50-60 25 lb boxes....... @7
40 - 50 25 Ib boxes....... @8
60 - 70 25 1b boxes... @ 74

lg Cent less in hage

Raisins.
London Layers........1 00@1 25
Loose Muscatels 2 Crown 3%
L: ose Musestels 3 Crown 334
Loose Museatels 4Crown 5

FOREIGN.
Currants.
Petesa Obie. @ 3%
Vostizzas 50 lb cases. -@ 33,

Schuit’s Cleaned 25 Ib bxs@ 5 :
schuit’s Cleaned 50 Ib bxs@ 434
Schuit’s Cleaned 1 lb pkg@ 6

Peel.
Sitron Leghorn 25 1b bx @I13
Lemon Leghorn 25 lb bx @l1

 

Orange Leghorn % lb bx @I2

 

 

  

Raisins.
Ondura 29 1b boxes...... 7@8
Sultana 20 lb boxes...... @6%,
Valencia 30 lb boxes... @i1%
FARINACEOUS GOODS.

Farina.
Bie 3

ic Grits.

Walsh-DeRoo Co.'s... ....2 00

Hominy.
Barmeis .... 0.5... 25
Flake, 50 1b. drums.......1 50

Lima Beans.

et... ie

Maccaroni and Vermicelli.

Domestic. 10 lb. box......
Imported, 24 Ib. box.. ...2 50
Pearl Barley.

Empire _..........-.-.... 23%
Chester. __............. Ta@e
Peas.

(yeeem, ba........--.--.-.- 90
Split, per Ib.. i
Rolled Oats.

Schumacher, bbl........ =: 60

Schumacher, % bbl.

  

Monarch, bbl........-- = is
Monarch, % bbl.........- is
Quaker, cases.......------ 3 20
Oven Baked.. 3 25
Lakeside .... 1s ce. ee
Sago.
eee 4
Bast lndia....-....... 3%
Wheat.
Cracked, bulk..........--- 3
242 1b packages ..2 40
Break fast ‘Food.
Pettijohn’s Best. _...3 10
Buck kwheat Flour.
Excelsior Self Rising.
Case of 2doz.:.....-...- 1 9)
Five case lots 1%

 
 

Fish.
pe
Georges cured.. . @ 4%
Georges genuine. oa @ 6
Georges selected...... @ 6%
Strips or bricks.. .6 @9
Halibut.
Chiumks. .....--..--.-----. 14
Sivips..... --3-.-----.--- . ll
Herring.

Holland white
Holland white
Norwegian

Round 100 Ibs..

Round 40 lbs.

hoops ke cE.
hoops bb 8 be

 
 

Sealed. ......-..-- + --s0s +> 12
lackerel.
No 1 100%bS. (0... LS

Moi Mike... --.-- ----

No.1 101bs...
No. 2 100 lbs. .-

  

No.2 @lbs..-.-.-.......-

No.2 10 1bs..--.--..-------

Pomily Oeibs.....-...-...-

Family 10 lbs.......-------
Sardines.

Russian = ee
ockfish.

No. 1, 100 1B cory 10%
No. 2) 100 lb. bales.. 8%
Trout.

No. 1 100 Ibs... .-...------- 5 50
No.1 #1ibs....-.-...------ 2 50
No.1 10 — ee eee 70
Ne.t Siie....-..----.---- 59
Whitetish.

No. 1 o.2 Fam

100 lbs. . .800 700 300
a6 Tbs. .....-- 350 310 14
10 lbs... = 85 45
6 ibe... 79 fi 39

FLAVORING EXTRACTS.

Souders’.
Oval bottle, with corkscrew.

Best in the

money.

Soul JULERS

Flavoring |i

 

world for the

Regular
Grade
Lemon.
doz

Regular
Vanilla.

XX Grade

 

Jennings.
Lemon Vanilla
2oz regular panel.. %%5 1 20

1oz regular panel..1 50 2 00
6 oz regular panel. .2 00 3 00
No. 3 taper......... 1 35 2 00
No 4 vaper......... 1 50 2 50
FLY PAPER.
Tanglefoot.
*Regular’’ Size.

Less than one case, per box 32
One to five cases, per case.. 2 75

Five to ten cases, percase. 2 65
Ten cases, per case........ 2 55
“Little” Tanglefoot.

Less than one case, perbox 13
One to ten cases. per case.. 1 45
Ten cases, per case........ 1 40
FURNITURE
Cleaner and Polish.
Henderson’s ‘‘Diamond.”’

 

arr... .-............ 1%

rt Cl Se

ort ae 5 40

malt Gatlion................ 7%

Galton... = |... 14 40
HERBS.

—. hh lCrC 15
Hops
GUNPOWDER.
Rifle— Dupont’s.
ere 3 00
Mat Bess...) Lal ee
QuarterKers.....- ......._. 1 00
op Cams... -... .. Oo
te Ib Gans................. : 18
Choke ao ae ‘

aoe ......

Half Kegs. ee eee ee 7 25
Quarter Kegs.. ee
11b cans. i 34

Eagle Duck— -Dupont's.
Kegs . .8 00

ai. 4.25

Quarter Kegs... .--.-..... - 2 2

Co 45
INDIGO.

Madras, 5 lb boxes......... 55
S. F.,2 3and5 lb boxes.... 50
JELLY.

15 Ib pele 34
71) pals... 40
050 PRAMS: 230. 60
LYE.

Condensed, 2 doz .......... i 20
Condensed, 4 doz........... 22
LICORICE.
Re 25
BCU ee ee 14
BOG 10

MINCE MEAT.

 

Mince meat, 3 Geni in case..2 75
Pie Prep. 3 doz in case...... 3 vb)
MATCHES.

Diamond Match Co.’s wee
No. 9 Suipner........ 5.54...

Anebor Farior.............. i ”

No.2 ome... 3... 110

Export Parior.............. 4 00
MOLASSES.
Blackstrap.

Sugar house...... ee cae 10@12
Cuba Baking.
Ordinary... 0. 12@14
Porto Rico.
pame. 20
Papey 2... 30
New Orleans.
ae. 18
Heed. 2
Eoaracood..:............. 24
meee 27
Raney 2... 30
Haif-barrels 3c extra.

OIL CANS.

Crystal vaive, per doz..... 4 00
Crystal valve, per gross. ..36 00
PICKLES.

Medium.

Barrels, 1,200 count........ 3 25
Half bbls, 600 count........ 213
Small.

Barrels, 2,400 count........ 4 2
Half bbls,” 1,200 count...... 2 63
PIPES.

Gisy, Ne: 26. 1 70
Clay, T. D. full count...... 65
Cob, No. 3....... i. oe
POTASH. |

48 cans in case.
Baers... ...:.. 5. 4 00
Penna Salt Co.’s........... 3 00

 

RICE.
Domestic.
Carolina head.............. 5%
Carolina No. 1,............ 5
Caroling: No. 2............. 4%
Broken. . 3
"Imported.
Japan, No.l... 4%
Japan, No.2... .....:. aa
Java, No. 1 Dee ec eee ee 5%
Java. No 2... 414
Pata ce
SAL SODA.
Granulated, bbls........ -1 10
Granulated, 100 lb cases..1 50
Tammp, bois... . 2... 1
Lump, 145lb kegs.......... 1 10
! SEEDS.
Amine gs: 13
Canary, Smyrna........... 6
Caraway ......:..... ..... 10
Cardamon, Malabar...... 80
Hemp, Russian.......... 4
Mixed Hird............... 4%
Mustard, white........... 6%
— feces eee eee lc 8
See cee. 4
Cattle Bone............... 20
SYRUPS.
Corn.
Barrels 15
Half bbls.. ae

Pure Cane.

 

16

20

25

SPICES.
Whole Sifted.

Allspice Pie -. 2. O86
Cassia, China in mats.___ |. 10,
Cassia, Batavia in bund... 15
Cassia, Saigon in rolls...... 32
Cloves, Amboyna........... 15
Cloves, Zanzibar............ 10

Mace, Batavia
Nutmegs, fancy..
Nutmegs, No. 1
Nutmegs, No. 2... a
Pepper, Singapore, black... _10
Pepper, Singapore, white. . =
Pepper, shot...
Pure Ground in Bulk.

 

AMepice 2.0

Cassia, Batavia .......... e
Cassia, Saigon.........._... 35
Cloves, Amboyns........... 15
Cloves, Zanzipar,........._. 10
Ginger, Atriean....... 0... 15

Ginger, Cochin

Mace, Batavia.... ..... 60@65

Mustard, Eng. and Trieste. .20
Mustard, Trieste 25
Nutmegs, NO: Bos 50@60
Pepper, Singapore, black9@12
Pepper, Singapore, white15@18
Pepper, Cayenne. ......- 17@20

8
**Absolute”’ in \41b. P
Allspice ie wee 3

  
 

Cigtamon...:... i
Cloves 7
Ginger, Cochin........._.. vb)
meee 2 10
Mustard...... ... vi)
Nutmegs.. 210
Pepper, cayenne icles ae
Pepper, white ............ ®
Pepper, black shot........ =
MAO

50
‘‘Absolute ’’Butchers’ Spices.
Wiener and Frankfurter.. =
Pork Sausage...
Bologna and Smoked S$’ oe
Liver S’ge and H’d Cheese..16
STARCH.

aT La

aoe “BLUING

eee Sr Ue orarenni ety
Liz Neo sli le Tae 2

 

berth
NEW HAVEN. C
CT er a) ia ni >
64 10e packages ...........5 00
128 5c: packages......... ..5 00
c32 10¢e and 64 5c packages...5 00
Kingsford’s Corn.

20 1-lb packages............. 64,
40 1 ib packages............. 614
Kingsford’s Silver Gloss.

40 1-Ib packages............. 6%
Glb boxes... ........ 1... 7
Common Corn.

Dae POMC es. 5

02) DORGS.....2....--..-<.. SE

 

 

— Mis sis

 

 

 

 

THE MICHIGAN TRADESMAN

21

 

 

 

 
 

 

 

 

 

 

 
 
 

 

 
 
 
   

 

 

 

  

 

 

 

 

 

   

 

 

 

 

 

 

 

  

 

   

 

 

 

 

 

 

 

 

 

    
 
 
 

<<é
Common Glos
S.
1-lb packages ......... 4% | Nick STOVE POLISH.
3-lb packages........ oe He a small, pergro. 4 00 Fancy—In Bulk.
we aa o Nickeline, large, per gro... 7 20| Lozenges, pl Pails) F.J pened: | -
Eye a *.. 7 20| Lozenges, plai _J. Dettenthaler’s Brands. | .
ee ss a 2 ‘ane Licarsxd —— : Lozenges, aad é Fairt onan a Provisions. | Crockery and
--tcue- Ort | Don & P ers ec... 7D Shoe. Drops... , “airhaven Counts i “|
SODA. ea & Perrin’s, small. ....2 7 Glide! Monnmonials M14@13 | F. J. a The Grat ; “~
Bawes ene a Halford, large’ noes is pola eae — @i2% J. D. Sélects....... W@ and Prov ast ae Packing | Glassw
as. * dai ee ae = ae ame 3 = aed oe ee @5 2 lows: o. quotes as fol- | = are.
See ee nia Bees ss int ae Moss 5S ..-.. @ 8 DWE |
SALT. Sal: eet eee 45) | Sour Drops. D : oon Barreled Pork. '
Diamond Crystal . ae SHAE... 2 65 oor a / @ : Standards... — a aie 10 25 LAMP BURNERS.
. Cases, 24 3-lb boxes. f ; MICIDE Fanc “jg oe or =o a <>? | No. 0 Sun
Barrels, 190 3 1b L- 3 = Zenoleum, 6 oz r i y—In 5 Ib. Boxes. Comes... aha Gal. past back pap os Sagi 0 =
Barrels, 40 7 lbbags...... 2 50 Zenoleum, gts. : eu 2 00 Lemon Drops.... Per Box Dire Selects | o.. @ 00 — eut.. Pe a No. a as a)
Butter, 56 lb bags.........-- 65 Zenoleum, ¥ gal......... - 400 Sour Drove. = Medium Selects.... a ; Ne — ee. 12 00 fubular. -
Butter, 20 14 1b bags......-- 3 oo | Zenoleum. ea re) a Peppermint Drops.. =. Anchor Standards. .. Gl 0 amil Security, No. | oy
Butter, 280 1b bbls... 2 50 SUGAR. ee SS ee Sane ce
: Common Gr E ° . M. Choe. D : Dw Gns (0... ia Dr utmeg wees 85
‘ 100 3 lb sacks..... — 260 Below are given New York Gum Drops.. _—- s @m Ciame ......... 7 wes Gl 5 Beles oe Salt M -, co 50
3 aoe 1 8% ec on sugars, to which the Licorice Drops...... ; = @50 Shrimps . - @ 25 Briskets | _. 6% . 115
posi lege hips Ee 1 70 relehe fi Ses adds the local z B. Licorice Drops (50 we Allyn’ Seas @1 25| Extra shorts............. 6 AMP CHIMNEYS—Common
Worcester. rom New York to y sozenges, plai i oe H rl 7 ; i
50 4 Ib. cartons ee shipping point, oi 7 Laneaeen a @55_ | Counts..... Per Can. | ia; Smoked Theat: ea Per box of 6 doz
ak eee : = credit on the invoice for aus Imperials ... ae @60 | Extra selects... Pt “a 12 1b average .... 9% | No. 1 eat i 4 8
60 5 lb. —. Looe. ce amount of freight buyer pa ni Mottoes..... cea @60 Plain Siege sete 30@ eee . lb average i at le 4 on ee
, 7. ae oe = from the market in which is Cream Bar.......... @65 a 20@, aie ps lb average... 4 No. 2 Sun... 1... ...... See
7 30 10 1b. sacks rae purchases to his shipping-poi Molasses Bar ....... @0 | Mediums .-.........2. 2G ws as, 20 lb average... 9 First :
= 98 Ib: linen sacks ‘ = including 20 pounds a Hand Made Creams. & @0 cae n= 20@ neue dried beet... O1 rst Quality.
a <6 1b. linen 8 5 ES weight of the barrel. 1€ | Plain Creams ams. 80 @M% Haveres 18@ epateengg (N. ¥. cut) él. No. @ Sun, crimp to
a — . , 8 Domino ...........- - -, | Decorated Creams... “ = a 16@ | Califor Clean 6'2 | wrapped and labeled "
3 a ee (ean. Ul . <5 | String Rock J. a New Wonk Couns Per Gal. i — Haws... 61% No. 1 Sun, erimp. to 10
' 56-Ib d : Ce 5 75 | Burnt Almonds... . _ @60 | Extra Selects eo. aie | WrapPed and inbeled..° #25
a dairy in drill bags. . ses Wi Almonds..... 12% @ Plain Sel A @1 7 Cooked ham.... ‘S'21No. 2 sun, cri 22
28-lb dairy — bags.. is | MeN Powdered | ne ae Berries @55 Ix Ste 5 i @1 5U In Tier 7 _ wrapped ead aber _
ton. M Ore 0... ' aramels ily 4 Standards. =i ot ’ -TCeS. wards. bs labelec a2
56 \b dairy i i. No. l wr re : Standards @1 20 | Compound...... | 2
ons iin . ' > pomnmareai in bbls... ... boxes sapped, ome @ 2 : : @1 10| Family...... a 44 XXX Flint.
4 56-Ib airy in aac Den 60 yranulated in bags i ci NO. I wrapped, 3. ib, @30 Gi Granger ... ee 5 PHP eT)
»G ‘ a 3 Ib. ee aU sls ae ; : n, crit yp
ar Rock. Fine Granulated... 5... Se) boxes.............  @a Grains and Feedstutis Musseliman’s Gold Leat. 644 | “wrapped and ee ae
56-lb sac =. ee dele 22 ~ saree boemabina comes its He 2 | No. 2 wrap, ed, 2 Ib we / ee ee ee oe) ee etl diag
ae Common Fine. shone gp nag gagat boxes .. i Wheat Wheat. pee ba White Clover an wn rapped and laneied ae
— oe 85 | Confee. Sisal a Ao Lo / a oe ee 6 Colcnet Sat pot Sun, crimp ian 2k
Manistee ara a S| Nol it mre A... FE 7 7 WwW _— Flour. 55 1b abs in 5% rapped and labeled 375
- N > a ag See a r of uocai Brands. aie ald Le ce 1 i
Scotch, in bladders.....--.- 37 a 2 saga ol ella ele sacl a wen 445 ruits. Pate = ele. - oo . tees Lagaune Ly CHIMNEYS,
accaboy, in jars. Se NO, Decree eee e cece eee eees 4 LON Pate \ oa ke ... advance 1 Peg r
French Rappee, in jars 8 = ee ree 4 Oranges Siraight........... a Ib Pails.......auivance i, | No ee
SALERATUS. No. 6 Po Fancy Navels a oe — el
P acked 6) ibs, in box. =. Bo. ee cece ee eee eee eee ee 4 50 eo... i ‘ Graham ..... a 3 io Pails. vdvance No. ih _ ste eteeee 3 70
= ‘tan fo re re — fcee ee | "d and
eines .....---.------- is 15 oe 6 4¢ Faney Seedli . ye ... a Sau 1. > Hi 4 an
cic pan HERS 3 30 — ES eee = 150-176-200. . : eer Subject to usual eask Bologna .. oo i No. = Binge, wrapped and "
ee 3 00 No. = ne 4 35 Sey see 3 0¢ | count. al cash dis- | Liver cc. be a labeled... 4 88
cols ea a ae N a eevee ccces sete e eee e eee 2 25 Fl ie rs ee ee 6 ae
emg ee oe 1 Bloom vail octet ae rorouaa| age a) Plain Tp
wee i oo es eet 35 Bie vette tees 34 1 Sun, p
G. J. jgueen s brand No if es 4 06 | strictly et Lemons. n alone n Grocer Co.'s Brand, nats vee 6481 No 2 si nese bulb trees 3 40
NO. 14... eee eee eee 3 ox | strictly c 10ice 360s in weer Ws. 8. Onleue | __... : an, plain bulb...... 4
No. 15. - - ——— aaee Soy @ - Qui oh) — 3 eG a ene a a ees 0
WASHING POWDER. Tl ancy 360s fies @3 Pe ee TE ioe ae _ es | i asia
oe @3 50 aoa ae 3 E Beef. lwo 1 a |
anes. 5...... 2 WE > )Xtra Mess No. 1 Sun. plain bulb a
Fancy 300s . @3 7 ena WwW Heat Fi lour. UXtTa, L oo jo ulb, per
i Y DUS. ...- eee ee a5 3 Juds Boneless : | ee ee ae
Extra 300s @3 50 | ,., acy on’s Brand. 1600. | \0-2 Sun, plai 1. boo
 .... @A4 00 Ceresota. ‘a a ay _ Pigs’ Feet. je in, plain bulb, per
7 oa Ceresota, '4s... oe 3 sb Kits, 5 PbS. a te le tener eer 1 50
100 packages in case........3 35 name, as i yuries nce este i fe 3 ta ‘3 nape = i | Lun | No.2€ nt - F - eo
CG ---3 30] size of. aries according to | Bal (oo 8 , | : O% 1 60
Ss siz : g§ to ul-bB t i)
Cw... 25 00 | No.0. pe — fr e of bunch and quality of |G Saruibart-Putie uns nn a i Tripe. Ot | ta
a B. J. Reynolds’ br: Cal x : pereross.... 8... 25 coat y G on Republic. tgs. ge | Bits, t> Tbs. Rochester.
2 ornet’s Nest...... No. 1, pergross.............. ~) | Medium bunches or _ grand Repubiic, a 7 1 1¢ bbls, a % | No. 1, Lime (te
—/_ @ H. & P. Drug Co.’s s bri ae a ae per BTOSS... sss se eee ee z Large bunches aie > = 50 pe Re puiaic! iS pay 3 bbls. - i | boo | No. 2) ae be — aise o
uintet é aoe 40 Ppa 5 @2 %| Lemon. 3 65 end ge geome hah enc ea
ete owen 35 00 per gross... Oh as Foreign Dried Fruits. a oT Cows Brand. | pork Casings. Care Flint (80e doz) 0
New O.'S wee 1s , Fancy Layers Paricinin, ea 3 95 Ce ee oe 25 | Electri .
Briek.... r amet 20 Ibs , eS =) | Beef round | ric.
AP. Sees ac ers. “ Choice I aye =? Parisian, 128... 2 | Beet mit — a 5 | No.2, Lime (70e d
° mina wt Ww ne : ae oe sakyers a ow ' Se +. 4“ INA oO a ae ‘aea) | 4
‘ Laundry. ‘ = Ne Y. Biseuit Co. quotes | p 10 Ib. . cc. @10 Bolted Meal. Rolls Butterine. | No. 2, Flint (b0¢ doz)...... 4 40
Gowans & S + i as follows: Figs Ni at : p POEL ae iat ee .- | Rolls, dairy #
Crow ans & Sons’ Brands. Butter bags ne turais in Granujated --++) 19) Solid, di lee 10 Miscellaneous D
Oe 310 . . ae Bee ee ”6 Feed and M cc oa 2 00| p aah llega A a a Ss. Oz
—- Family. Tt Bigs — NX sale _ Fards in 101b @6 | st. ceeds Millstuffs. | ey creamery | Junior, Rochester |
American Grocer “100s. ""° 3 sel ® ymour XXX, 3 1b. ‘Garton 55 wed ..... ls ae Gas Peed. Cee ea Bee id, creamery Pea aw
American Grocer 60s.... .3 amily XXX. a Dates, Fards “un 0 ib @ gt i eee - unscreened. .13 00 | Canned Meats. re luni: ison hieeng ain ‘5
N. GC... -- 2 © Family XXX, 31b cart Bar cases a vo. | Corn and Oats 71 $ sorned beef, 2 lt ie a ; Bases......... 1
Mystic White. vette eee ees 3 30] Salted XXX. rton. 53; | Dates, Persians,°G. @ 6 | Unbolted Corn Men S 7 | Corned be ef, a | Barrel lots, = WW)
——— 3 80 | Salted XXX, 3 1b earton... 3 M.K —— ee ee Bran... .2211 50 | Roast, bee 2 Ip: pospugrgokeg ades..... 1 00
senses eee ' _ = " *aSeS. . . . 50 | p i... se lots, '
i. _.. ; 9 Badal »4/Dates, Sairs 60 Ib @5 - nec! Wheat Middlings. .12 60 | Potted sie 14s ea... 0
aoe . 3.30} Soda MMM 0. : eases enings.... Wi ha | Potted ham. ‘4s Mammoth Chimneys :
Happy fe . 2 55 | Soda a pad carton... 2 — 4% The Oo. B airs Mi < | Deviled ham, Ys. nag Store
-... o sae “gf a a 2 quotes as follows: E SEE Co. | sib ham, ‘Ss... 1 No. 3 Rochester. lt a a
sry sta Wafer Ce aig | Potted tongue 4s .. | No. 3 Roche il tad 4 20
Long Island W eae |) " Nuts. Car lots Corn. Potted tongue Ses | No.3 neg wp hi Hint lm 4)
L. 1. Wafers, 1 Ib carton i 12 —_______— Less than ‘eal ar ‘lots oe rs | : i Jewel : vi iss ae 18 5
Oyster ae Se No.2 Globe Inei 5 BW
> Ss » 21 = £ monds, Tarrag : ag Oats. | obe Inecandes.
os esa om oe 3 2 Sore RX, nae ee 51, | Almonds, Paragon. @ HS) | Cur lots... ee al Fresh Meats. | x nt oe lw 5 10
: Si1V 2 9 es - : a, : ae + oot | c Wobe Incan is,
10 box lots. delivered. -3 20 | Farina Oyster, XXX wee Almonds, California, i Less than ear lots.....0... 2 ne Beef. ity ee
7 Jas. S. Kirk & Co.'s ‘id ae : Bae sheted... @12% Hay. | Carcass «6-0... +: ae P earl giass..... 2 a oe
—— oe ee - ooapiil @12'% | No, 1 Timothy, ton lots ...16 00 Fore quarters.........4 @5 | one
! merican Family, plain....3 27 ee ae eae ior, | Walnuts, Gren., ney @io | No Timothy carlots.. es 00 | ~yersed quarters........ 6 @ au OIL CANS. Doz
‘autz Bros. & Co.’s brands. ent’s Cold Water......... 2 |W alnuts, dite new. @i2 | Loins No. 3........... 9 @I0 1 gal tin cans witl a
— a 335 Belle Rose.... . tw mi Calif No. 1. @l2 Hid _ Co <2 @'0 | 1 gal galv iron oa spout.. 1 60
a NOME oa vossee set veses IS... | Belle Rose... ss. .-.-. alnuts 1. @R Bibs —---------- «1-1 8 GU | agal galy i ith spout. 2 |
, ee 1115 a oar ag Soca 8 oa os = and Pelts. | oe ee eo oie ice wie Spout. 325
a a ae S... ous Ns ou [csc “ lp eens toe eee e @ 5 gal galv Ir rj : qr
ie ; = Frosted Honey. ‘ee ae Nuts, fancy @l2 Perkins & Hess pay as f | Plates ........ : Sy lo eal oe aa. spout. 4 0
: Henry Passolt’s and 70 | Graham Cracke il oe Nuts, choice... @ 9! lows: ae Pe fol- | Rok | 3 @ 3% | 5 gal Wien with spout 6 50
&. “ Ginger Snaps, XXX ecans; Texas H.P... 7 @ 8 : Hid Dressed ...... i oe = cal galv i sna ith faucet.. 7 00
; ( : round. 64 | Hickory Nuts pe a) —] les. ry es 14@ 5 ® gal galv tron A& W ra
; finger Snaps, XXX city... 6% | Ohi y Nuts per bu., Green... |... m5 OiNS ..........-- @ 2, |dagal Tilting cat Ye ae
’ Gin, Snps,XXX home - 6%], hid... .. ee a4 oc,| Part eured.....-.. 1 | ae Shoulders... 1.0.0... @ (215 gal galv ng cans, M’'n’eh 10 50
‘ made 6% | Cocoa : @1 2% Le E ae @ 6 gal galy iron Nacef
: Gin. Snps,X XX scalloped.. Giz aoe full saeks @4 00 Hull Gued ‘ @ 514 Tessa . G 614 n Nacefas.... 9 00
& Ginger Vanilla.......... 3 | Black al, perbu.. @ eS Tm en es Mutton. bat Pump Cans
. Imperials — i alnuts per b : Kips. gree 4 Careass ... : sl ce .
pera .................. 8 I u @ LIPS. STEEM.....--.--- eas | era gape boy See | oo Home Rule |
t — Honey......- uoiPp Peanuts ee 114, BU | pring Lambs........ 6 ee | 2 Bl Home Rule. a
: nlncnes Oaea. 000 : fancy, H. P tore | Calfskins, gree foe tas Veal. * |SealG lacie ty ---- be W
Aono 8 _Coe tks P., Game | Calfskins [ as oes > @o6 Careass .... oe yoodenough eden ets 11 50
Wo fe Pca aa asi . ns, cured. BUG 7 0. ate Gta | gal Goodenough
Marshmallow Creams..... 16 ancy, H. P., a @ 5% | Deaconskins .... 0... aa to 2 | ogal Pirate ing) oe
Pretzels, Manaiadel (oll : : RO ScEwaE Pelts. co @30 | is 2 oe
V retzelettes, Little German a Fancy, H. P.. eek @ i Shearlings .... .. 100 @ 3 | Oils. | LANTERNS.
Sugar Cake........ Pt ett Winans Roasted ' A | Lambs Te a Se |No. Tubular
’ Single box. a on Sultanas .... ie 12 Choice, H. P., Extras. G ‘+ | Old Wool...... ae = 00| The Standard Oil Co quotes Nol 1B tubelee a i
5 box lots, delivered .......3 20 Sears’ Lunch........ oe Choice, H. P., Extras, " i Wool. @ % | as follows: i S| No. s TN ibul ar Dash.. .... oan
10 box lots, delivered....... 3 15 Vanilla Square........... a Roasted 00000011. as | Washed .... ......--. 10 @I7 | Barrels. | No. 17 t glass fount... oa
25 box lots, delivered....... 3 10 pga Ne Weare || - a @, | Unwashed ...........- 2 ots | mee ene . @ll | No. 12 T ces a ea i 00
Thompson & & Chute's ae Pec an Wafers. ._ i 5 Fi h TE! Tliscelianeous. a W.W. Mich.Hdlt @9° | No. 2Street Lamp...... P 7 =
ee — : is iad 0 ei x@3 | Binh Test Headlight. @ 8% | i a
rease Butte igh Test Headlig te LANTERN G 5
Candies. : ysters | Switches Pee 1 ; ee @ ou No. 0 Tubular sisi go
ih Puknaan ae a guetes Pe 50@2 | Deo. Napanee 000400... @ S2 | cach, box 10 cents sina ee
os cela: sandy Co. quotes "Fresh Fish. —. pe 02 90 =: eae 0) a a 4 | No. 0 Tubular, ¢ ee 45
* i yor | MIME ....-..-....- a ol fngine / a 7 : | each, box 15 ce oe 10Z. i
a oe : Whitefish ........... a - a — 125| Black, winter......... 7 =s | No. 0 Tul butar, ten 6 & mn "
a bbls. pails ae ee a es | Skunk. ..... Oe — Black, summer > AE ay 1 os. il
Standard Be oe t iA i: aga @ 15 n Winter oo. oo, | hina From Tank Wagon. oo No. 0 vulialer, ea a 40
} | Standard Twist..... sa (A| Grscoes or E we « la Fall........++. we al XXX W. @ 9% | cases 1 doz. each..... oe
| Cut fost... 2@ 1” ; Blue: lerring. i @ 6 oe 1 00@ 1 95, | >. 8 2 W. ‘Mich. Halt. @ 6% | ro) 7
Sit le tor | extra HH | Live Lobster....... e a oe Wes Te 2 “= ] 60 | .S. Gas......0..-..- @7 |, LAMP WICKS.
: is e box. .. pase allitteaand (0 Boiled Lobster...... @ | Budser ...... aN 00@ 5 00) Scofield, Shurmer & Teag No. 0 per gross......... 24
5 box lot, delivered. . | ream...... Cod : 20 Cat, Wil -... 20@ 50] quote as foll & Teagle| No. 1 per gross t
@ 10 box lot, de'ivered 3 15 | Mixed Candy. laddook 0 @ W | Cat He Bistransers . 40@ 701 aa No. 2 per gross.....-.--+..- cr
25 box lot, deliv pet 10 | Stendard = pails No. 1 Pickerel Sh ker ea 10@ 3D | Palacine — G No. 3 per gross............. a
v Alien i —s s brands. i] Seer css. 54@ 6 mee @ : TY ; = 6 00| Daisy White.......... @ - Mammoth per doz......... 5
mtry 80 tib....... ele f Smoked W ae @ ¢ ee @ 2 50| Red Cross, W. W...... od peisierteiein iat eciinNEaH AE
ee seocsnngang oe 90 | eis aa Red koa White... cn @ % Pinay TT a 1 50@ 3 00 | Ww i wie Dg ne e+ TUMBLERS—Tin Top
- pores ex ae 3 65 | Broken oo eee oo ae Salmon.. é : epee CC Nt : pes to 00 | i Headlight. @8° , Potaoggs: 6 doz in box, per '
ng. ali PEL ei eisie pe sic sic: wie Mackere nn « | eee mM 2 t x " — t
i sepolio, kitchen, 3 do 2 Kindergarten....... squat enn eae 16@ 20 | RO a ele aaa 5 00@15 00 | aieoue ae @ 8% | > Pit On Be i er 70
: ese. Rend, 2 Saogs ..... 40 | French Cream Shell Goods Beaver 3 00a. 7 00 | ove Gasoline....... @ 9 g Pints, 20 doz in bbl, per
, hand, 3 doz ........ 240° Valley Cream....... Oysters, per 100 "1 25@1 | Opossum ...........- 100. o From Tank Wagon 5 | Cae Uae OS)» = 5+ + x
Le ae oe Clams weeee-- 1h 250@1 50| Beavercasto a 18| Palacine.... 7 144 Pints, 6 doz in box, pe ie
» per 100 rs per lb 3 00@ 8 / @ye k X, per
ae 9@1 00 Deerskins,dry,perlb 1 @ 00 Red Cross W. W. @ 63 0X (box 00). 90
oa 2 Gasdline............ oS ae tg Pints, 18 doz in bbl, 1 per |
hl 7% doz (bbI 3). . ll 25

 

 

 

symm nae ttetsterse HOE tt

deemed the great *‘

22

THE MICHIGAN TRADESMAN

 

 

WHISKY AS MONEY.
Written for the TRADESMAN.

It takes money to buy whisky. Many
aman, even in this enlightened day,
knows this to his sorrow. That whisky
was ever money itself is a fact not gen-
erally known by the young men of our
times. There was a time in the history
of this Long Point section of Ontario,
however, when such was the case; in
fact, during a portion of the first quar-
ter of the present century, whisky was
pretty much the only kind of money in
use in this country. It was more than
a commodity of barter—it was money.

In order to understand this statement
of fact, it must be remembered that
money is a medium of exchange. It is
the representative of a certain value
that passes current as a liquidator of
debts and a purchaser of commodities.
If it were interchangeable for certain
commodities only, and possessed not
the advantage of being a free and ac-
ceptable tender in the cancellation of
debts, it would be a commodity of barter
merely and not money. The man who
penetrates the interior of Africa, for in-
stance, for purposes of trade must sup-
ply himself with the kind of money
which the natives recognize as current
medium of exchange. Were the trader
to tender payment in British gold sov-
ereigns or American national bank
notes, the natives would not part with
their ivory, gums and other merchan-
dise. Money is what they demand in ex-
change for their goods, and in this re-
spect they are similar to us and all
other nations. Like us, they demand a
representative of value that acts as a
circulating medium of exchange—a
something with which they are enabled
to pay their debts and purchase com-
modities; hence we find that strings of
beads, coils of brass wire, and cotton
cloth, provided the beads and _ cotton
are of a certain color—or, in other
words, bear the proper mint stampage—
are money in that benighted continent.
A barbarous people place little faith in
neighboring tribes or in each other, and
hence the only medium of exchange
they ever adopt must possess intrinsic
value.

But I dare not pursue this line of
thought further, as I might be caught in
some political economy trap.

It was not a matter of choice on the
part of an uncivilized people that made
whisky a medium of exchange at the
time referred to, although it is hard to
conceive how any civilized people could
become reconciled to such a custom.
It was a period when the primitive con-
dition of settlement had outgrown itself,
but had not yet reached that stage of
development when the needs of the peo-
ple are supplied by a preperly devised
monetary system. It was a time when
barter no longer met all demands in
business transactions, and when gold
and silver coins were objects of curios-
ity, owing to their exceeding scarcity.
A great need was felt for some medium
of exchange that would facilitate the
transaction of an increased buisness.
This section of country was particularly
adapted to the growth of rye and Indian
corn, and, the country being supplied
with numerous distilleries, these two
cereals became the staple crops. The
distilleries furnished a ready market
for. the surplus grain produced by the
settlers, and, as there was an inadequate
supply of currency, the farmers were
compelled to take more or less whisky | =
in payment for their grain. In those
days whisky was an everyday article of
consumption among the people. It was
panacea for all the

 

ills that flesh is heir to,’’ and no house-
hold was complete in its appointments
without a liberal supply of ‘‘the need-
ful’’ on hand, so that, in cases of emer-
gency, the good man of the house might
not be caught, as were the foolish vir-
gins, with empty vessels.

It was an important item in the stor-
ing, transportation and distribution of
supplies. Every storekeeper kept it,
and the luckless dealer who so far for-
got himself as to ‘‘ run out of stock”’
found himself in a worse predicament
than would be the case of a grocer to-
day, were he to run out of tea, sugar
and coffee.

Thus, a 50-gallon cask of whisky be-
came the Almighty Dollar of this crude
period of provincial growth. The
wealthier classes hoarded it up in their
cellars, where the longer it was kept the
more valuable it became. In this way
it was money, bearing good interest
and at the same time retained in pos-
session. Considerations in labor con-
tracts were based on barrels of whisky
in lieu of dollars. A barrel of whisky
was as powerful, as a purchasing agent,
as ‘‘a coin of the king’s realm’’ was in
the heart of old London. Whisky was
money.

’ There is one case on record where
this liquid money was used in a manner
showing the extraordinary power it must
have possessed as a purchasing lever
A woman married a man.in_ considera-
tion of a barrel of whisky! After the
marriage the man stole the whisky, se-
creted it, and in due course of time,
guzzled it down. If this fellow had
lived in our day, he would have secured

a ‘‘corner’’ on life itself.
E. A. OWEN.
$22
How a New Depositor Carried the
Book Away.

Banking is not nearly so prosiac as
some people imagine. One is_perpet-
ually coming in contact with queer
characters and amusing incidents are of
frequent occurrence. Many persons are
peculiarly ignorant of the objects and
methods of a bank. A simple matter
like the indorsing of checks is always
a puzzle to most women, who often
seem quite incapable of understanding
the difference between one that is
‘‘crossed’’ and one that is ‘‘open,’’
and between a check payable to‘ or-
der’’ and one payable to ‘‘ bearer.’

A man who had accumulated savings
to a considerable amount decided to open
a banking account. Matters having
been arranged, he arrived one morning
with the money to be deposited and
handed it over the counter. The cashier
counted it and said: ‘‘All right, sir.
Ycur signature, if you please. ’’

At the same time he passed across the
counter the large book containing de-
positcrs’ signatures. What was the
cashier’s surprise to see the new customer
place the heavy volume under his arm
and stagger off with it. A clerk had
tu be sent in pursuit and when the
man came back he said he thought what
he had taken was the receipt for the
money.

ee
A Love of Candor.

Impecunious Man—I wish you would
be so kind as to lend me five dollars.
I’ll pay you back in a few days.

Candid Friend—If you had asked me
for the loan in a candid and straight-
forward manner I would have lent you
the money, but asking me in the way
you did causes me to distrust you.

‘*T don’t understand you.’

“You asked me to be so kind as to
lend you five dollars.’’

ee you had been candid you would
have said to me: ‘Beso stupid, be such
an ignomiious ass, such a_ hopeless
idiot as to lend me five dollars,’ and
you might have got it.’

 

OOMPUTING SOALES

More than 19,000 in use

 

 

 

 

ALE COe
eS ToMe ONL Oe -

 

At prices ranging from $15 up
wards. The style shown in this cut

$30.00

which includes Seamless Brass
Scoop.

This is not a real Computing
Seale, it being necessary to make
mental calculations. It is also
limited in capacity. You can sell
in fractions in the following
prices per Ib. only: 3%, 4%, 514,
6%, 7%, 814, 9%, 12% cents. This
eannot be ‘avoided, on account of
the construction and the limited
capacity in this style of scale. It
is equal in every respect to all
scales of this style sold at much
higher prices.

For advertisement of our World Famous Standard
Market DAYTON COMPUTING SCALES, see last

page of cover in this issue.

The Computing Scale Co.,

Dayton, Ohio.

 

Aa

~4~—~-_>—_4+>~ 2 s>--s>-—>—

 

Fy

 

A

Established 1566.

 

—_— A

ae ea

When in want of a new roof or repairs you can save money by
employing skilled mechanics in this line. We have representa-
tives covering the State of Michigan regularly, and if you have
a defective roof, drop us a card and we will call on you, exam- ,
ine your roof and give you an estimate of the cost of necessary
4 repairs or putting on new roof.

Remember that we guarantee all our work and our guarantee is good.

H. M. Reynolds & Son,

W et

Practical
Roofers.

Grand Rapids, Mich.

 

EY

 

— So ee ae ee ee ee yy Si cana —

Se Ne ee

 

 

9 ANCHOR BRAND ASPHALT

WARREN'S S3<208 58330 SP". ROOFING
Our roofing materials are manufactured from Trinidad
Pitch Lake Asphalt and contain no coal tarin any form.

ROOFING AND PAVING MATERIALS,
Asphalt Paints and Roof Coating, Sheathing Felts, etc.
Write for samples, circulars and prices to

WARREN CHEMICAL AND MANUFACTURING CO.,

1120 Chamber of Commerce.

 

  
   
  
  
   

DETROIT.

 

All Jobbers pave them

 

5° CIGARS.

 

 

 

 

 

 

THE MICHIGAN TRADESMAN 238

 

LARGE SALARIES.

Trust Placed in Heads of Depart-
ments in Gotham.
From the New York Sun.

The buyer in one of the departments
of a big Sixth avenue dry goods store
gave up his place not long ago, and
transferred himself to another big store
in Twenty-third street. It was said
that he made the change because he
saw opportunities of increasing his in-
come by doing so, yet rumor had it that
he received a salary of $16,000 a year
in the Sixth avenue establishment, in
addition to a percentage of the profits
of the deparmtent of which he had
charge. At the time he was said to be
worth $250,000, all of which he had ac-
cumulated as a salaried employe in dry
good stores.

His case may surprise people who
judge of the money making possibilities
of all employes in department stores by
the low earnings of most salesmen and
saleswomen. It is true that his case
is an exceptional one. He is rather
noted in the trade for his knowledge of
the materials dealt in by _ is cepart-
ment, and for his instinctive and cor-
rect judgment of the directions which
fashions of the moment may be taking.
Ability to guage the future of styles 1s
about as valuable and rare a quality as
ability to foresee the fluctuations of the
stock. market. Besides his special
knowledge and foresight, he has good
business capacity, so that altogether he
is an exceptionally able man, and would
have succeeded in any line. Neverthe-
less, his case is not phenomenal for the
amount of money he makes. Some
time ago, when a dry goods firm wanted
to make a special effort to increase its
business, it cast about in the other
stores for the men best suited for its
purposes. The men it fixed upon re-
ceived offers of $8,000, $10,000, and
$12,000 a year to tempt them to accept
places.

These amounts are all above the av-
erage of the salaries paid to buyers in
the principal dry goods stores; but the
best taste, judgment, and business ca-
pacity cannnot be purchased for much
less, and a big firm would not be apt to
hesitate about the salary if it found a
man that suited it. The operations of
a great department store are so varied
and complicated, and the details of the
business are so innumerable, that no set
of partners could begin to attend to
them all. So subordinates are endowed
with full control of their respective de-
partments, and are held to_ strict re-
sponsibility and accountability. The
latitude allowed them differs with va-
rious firms. In one old-established
house the head of the firm requires a
statement to be presented to him every
morning showing the purchases, the
sales, and the stock on hand in each de-
partment. Should the sales fall greatly
below the purchases in any department
he makes an investigation and consults
with the buyer as to how business may
be stimulated, instructing him in the
meantime to curtail his purchases of
stock. The tendency in the bigger,
newer, and more successful houses is
to allow the buyer to have absolute con-
trol, and to manage the business as if
it were his own. A certain amount of
capital is put at his disposal; he is
charged with interest upon it and with
his share of the rental, expenses,.and
cost of help, and at the end of the year
he is required to show a profit of a_cer-
tain amount upon the operations of the
department. He buys his goods, ad-
vertises them, offers bargains, and 1n-
vents his own devices for attracting
people, and is under only the most gen-
eral supervision of the firm. Naturally,
men in whom confidence to such a de-
gree may be placed are rare, and com-
mand a high salary.

Such a man would have an assistant
buyer, or maybe several buyers, under
his orders. Before the day of big de-
partment stores,such buyers would have
been merchants in business for them-
selves. Several big stores in this city
have been established by men who
learned the dry goods business as_ buy-
ers and incidentally gained the confi-
dence of wholesale merchants who fur-

 

nished the credit and capital that en-
abled them to begin business.
Drummers who deal with them say
that the increasing power and respon-
sibilities of buyers have tended to
make them haughty. In most houses
the buyers protect themselves against
drummers by codes of rules which the
drummers don’t like and which the
office boys take pleasure ir enforcing
rigorously. Thus,one house forbids the
admittance of drummers into the sam-
ple room before 5 p. m. One drummer
complains that he arrived at one minute
to 5, and was ignominiously kept out
by an office boy. In another house a
buyer has made quite a reputation for
himself by the cordial manner with
which he rushes, with outstretched hand
and wide smile, to meet the drummer,
while at the same time he bawls:
‘‘Nothing in your line to-day, sir!’,
The drummers do not object to the
cordiality in itself, but they think the
buver should make it plain that it is
only cordiality. At present, they say,
it gives the impression that the buyer
is eager to buy, whereas, it is on record
that one drummer was lured on by the
smile and handshake until he had made
sixteen calls in sixteen successive
months without effecting a sale. Most
drummers get tired of the cordiality
before making such a record.
—____~<»>¢<.__

Strategy and Chance.

An underwear drummer sat in a Cin-
cinnati hotel the other day and told this
story. He told it with a gleeful guffaw,
for it called up memories of a_ pleasant
nature.

‘‘Jack and I were working about the
same route in 187—,’’ he said. ‘‘We
had been keeping our eyes on each
other for two or three years pretty close-
ly. We were personal friends—but
that’s another story.

‘*In those days we started later than
we do nowadays. We weren’t so greedy.
I managed to know about when Jack
was ready to start for Philadelphia, our
first town. We took in Pittsburg and
Cincinnati, then, on our westward trip,
and so on, into the Western wilds, twist-
ing around and back again by Chicago,
Cleveland and Buffalo. And we were
within a day of each other either way
throughout the whole swinging of the
circle.

‘This particular year Jack packed up
his samples, and got away the morning
before Decoration Day. He went
quietly, like a thief in the night, and I
found it out just in time to take the
night train. I was just a little riled at
Jack, and I prepared what I supposed
was a coup d'etat. Instead of stopping
at Philadelphia I went straight through
to Cincinnati, expecting to head him
off by at least twenty-four hours.

‘*T walked into the billiard room here
at the Gibson House, and almost into
Jack! He said ‘Hullo!’ cheerily, and
the blood froze in my veins.

‘‘T said, ‘When did you get here?’
and was relieved to find he had arrived
in the morning, and hadn't been able
to do any business because of the holi-
day.

“Early next morning I went to J—'s
place. J--- was one of my best cus-
tomers, and I had an idea | could get
the better of Jack in that quarter. But
Jack had been there before me, and had
an engagement for 10 o'clock,

‘* «Tell you what I'll do,’ said J i
‘I'll take your samples and Jack’s, anc
we'll go through both lines together.
You can leave them here, together.’

‘‘While we were talking Jack walked
in. There was a confab, and finally
Jack agreed. We sent our samples up,
and Jack and I walked out. ‘Don’t
know what we're going to do,’ said
Jack, ‘but I’m going to the races! We
haven't any samples. Can’t sell goods.
Come with me.’ I declined to accom-
pany him. Pleaded an engagement at
the hotel and left him.

‘*T had almost reached the hotel, when
I suddenly remembered that I had sent
a complete line of samples a few days
before to A——- and B——, anda bright
thought struck me. Went to A—— and
B——, and asked for loan of the line
fora day. A—— and B—-— said ‘Cer-
tainly.’ I got the samples and saw four

 

firms. I sold unspeakable bills. And| CON!
all the time Jack was at the races, |
happy and contented. J ce

‘*He was the maddest man I ever saw)  miwaten
when he found it out. But I said, * Jack ; eN er
you're all right. Look at the bets yout | give these to their depositors. yr peso ee oe os
won!’ ‘Won your eye!’ said l Jack in realy Al — for them or send to us for prices and
2 |“ ALVORD-BOLTON CO., MFRS.

: | | 29 GRAND RIVER AVE., DETROIT, MICH. U.B.A
In Limbo Through Limburger. |

Two policemen have succeeded in|
capturing a burglar in Chicago. This | e
is a remarkable fact, as most robberies | ( oth 1 ni
go undetected, and this would probably
not have broken the record except that |
the burglar was an epicure. He might |
have gotten safely away with the family |
watches and silver, except that, just as
he started to leave, he spied a brick of
Limburger cheese in the ice box. It| anteed as low as can be made. Mail
was too much temptation for him. He} orders promptly attended to by

was aware that Limburger cheese is apt | MICHAEL KOLB & SON,
to give its possessor away, and he hesi- | Wholesale Clothing Manufacturers,
tated, but finally took it along with the | ROCHESTER, N. Y.

CONN COrn!it
TI Should be neatly and a&
\ curately wrapped before
A banking. We make the
ONLY device for doing it
properly

   

 

Our Spring line of Ready-made

Includes all the latest Novelties in ad-
dition to our complete line of Staples.
Write our Michigan Representative,
William Connor, Box 346, Marshall,
Mich., who will call upon you with
samples. We guarantee fitand excel-
lently made garments and prices guar-

other booty and stole out into the silent William Connor will be at Sweet's Hotel,
night. As he walked along the street | Grand Rapids, _sich.., Thursday and Friday,
the Limburger began to attract atten- | March 26th and 27th.

tion, and people edged over to the other |
side of the pavement. Finally, it
reached even the nostrils of two police-
men who were smelling around for
clews, and they arrested the man. Here-
after the burglar will be more careful
of what he takes. The sleuth-hound
detective may not find every clew, but |
when he smells Limburger he’s dead on
to the game.

 

We have just opened
up’a complete and well-
assorted stock of
choice Field and Gar-
den Seeds in Bulk,
which we offer at
wholesale and retail at

‘‘Well, John '’ said old man Jordan bottom = his
to his young friend, ‘‘you have just stock is all new.

been married, I hear?’’
‘‘Ves, sir,’’ he answered with a
spring morning smile; ‘‘just a month |
ago, and I want you to go up to dinner Highest market price paid for Beans.

ee BEACH, COOK & C0.

‘*Have you got a cook?’’
oe No. ?
128 to 132 W. Bridge St.,
Grand Rapids.

> 20> ___
Very Considerate.

 

‘‘Well, my boy, s’pose we go toa|
restaurant this time. You must remem- |
ber I had a young wife once myself.’’

 

 

 

 

We offer in this issue of the Tradesman the ee
greatest offer ever made on a staple article like flour. oe
We guarantee the flour equal to any second e
patent flour manufactured in Michigan. The silver- 6
ware is warranted by the manufacturers for ten e
years. The articles are new in design, very attrac- e@
tive and handsome. ' i e
We will hold the offer open until April 1. We e
have only one ¢carload of silverware on hand. It e@
will be first come, first served: late orders may have e
to wait until we can obtain more silverware from e
the factory. e
@
With 10 barrel order we will send an elegant °
tea set, Comprising teapot, sugar, creamer and = @
tray, or teapot, sugar, creamer and spoonholder @
of a larger and different design. $
With order for 5 barrels an elegant water @
pitcher or individual sugar and creamer. a
With order for 3 barrels your choice of °
cracker jar, nut bowl, soup ladle, cake dish, e

syrup pitcher or pie knife. ee

With one barrel choice of napkin ring, cup, zs

and a score of other articles. ee

ee

We name the extremely low price of %3.60 per
barrel, F. O. B. Saginaw.
current exchange.

ete des”

Cash with order in

   

 

The James Stewart Co.,

 

   

(LIMITED)
SAGINAW, MICH.
MT

 

 

|
}
:
:
:
|
'
|

NEETU NRREREAE NING UPPER NER

 

24

THE MICHIGAN

TRADESMAN

 

 

GOTHAM GOSSIP.

News from the Metropolis---Index of
the Market.
gpecial Correspondence.

New York, Mar. 14—-The convention
of canned goods packers at the Cosmo-
politan Hotel this week has been {some-
thing of a break in the usual routine.
Not many were present, and it is hoped
that future meetings will be more lib-
erally attended. Some representatives
of Western associations were here and
some sort of understanding was sought
regarding the prices of cauned goods,
and whether the existing demoralization
could not be overcome. The Western
men say that the people East are the
price cutters. They say that tomatoes
are sold at an equivalent of 67%c in
Chicago, when they would just as read-
ily bring 75c.

The exhibit of machinery was a_ very
interesting feature of the meeting.

The coffee trade is steady and, upon
the whole, firmer than last week. The
supply is not excessive here. Fair Rio
is held at about 133¢c. The amount
afloat is 481,084 bags, against 439, 129
bags at this time last year. In mild
sorts quite a volume of business has been
done. The market is firm and buyers
do not haggle over prices. Fancy Java
28@31c ; Mocha 23@23'c; Laguyra 18%
@ig34¢.

Refined sugars remain unchanged
and have been held at the same figures
for several weeks. Expectations of a
rise have existed for some time but
there seems no immediate prospect of
an advance. However, no one can tell
when the change will come.

Teas are steady for Ceylon and Java
and these sorts show steady growth in
popularity. Chinas are dull and seem
to have seen their best days.

The spice market is rather quiet and
prices are practically unchanged.
Stocks are not excessive but are suffi-
cient for the demand.

Canned goods _ are
scarcely any demand. The entire mar-
ket appears demoralized. It was hoped,
not long ago, that by this time consid-
erable trade in futures would be devel-
oped ; but such is not the case. Goods
are selling at prices ruinously low, and
the best that can be said is that they
are steady on the present basis. Re-
ports from California all tell of good
prospects, and the promise now is for
the usual abundant crops. Stocks of
last year’s goods seem ample and some
of the big packers see very little encour-
agement before them.

Molasses is steady for best grades.
Trading is of an everyday character,
but there seems to be no particular anx-
iety to get rid of goods on the part of
holders.

Syrups are steady and the demand is
sufficiently large to prevent accumula-
tion. Neither buyers nor sellers seem
at all anxious and the outlook is for an
even distribution for some time to
come.

Lemons and oranges begin to show
more strength and the auction sales are
developing considerable interest. Cali-
fornia oranges are fairly steady. Bana-
nas are dull and Aspinwall firsts cannot
be quotec at more than goc@$1_ per
bunch. Dried fruits, both foreign and
domestic, are moving with more free-
dom.

Butter has shown more strength dur-
ing the week, best Western creamery
selling at 22c. Under grades are mov-
ing slowly, exporters taking very little.

Cheese is selling in a moderate way
and at quotations showing very little
change one way or the other. Quite a
fair number of orders from out of town
have come by mail and the distribution
has been very wide. Considerable ex-
port trade is being transacted, but in
the usual undesirable grades.

Eggs continue in ample supply. For
best grades the market is about I2c.
Some fine Western sold at 113¢c.

Jeans and peas are steady, choice
peas selling at $1.20@1.25. Medium
are quiet and the tendency 1s toward a
lower basis.

The abandonment of the bicycle as
an enthusiastic fad has led to the clos-
ing of a number of the academies which

meeting with

 

a year ago prospered in every available
hall. Many have already closed their
doors and others are preparing to do so.
But the bicycle flourishes now In at
least one respect in which it was almost
unknown when the craze began. The
grooms who go from the stables in
which they are occupied to the houses
of their employers have begun to make
regular use of the wheel asa quicker
and easier method than pedestrianism.
When the weather is half way decent
numbers of these men can be seen In
the East and West Side streets in the
neighborhood of the stables starting out,
and in not a few cases they have be-
come expert enough to carry packages
along with them. As early as last sum-
mer people learned that a bicycle
could, in certain cases, readily accom-
plish the work that formerly required
an extra horse. Grooms could ride for
the mail and deliver messages on bi-
cycles as well as on horseback, and it
was not long before the advantages of
this arrangement began to make pro-
ficiency on the bicycle a necessary tea-
ture of a groom’s qualifications. The
loss of patronage, which has made the
academies less profitable this year, 1s
attributed as much to the fact that near-
ly everybody who wants to has learned
to ride, as well as to the small enjoy-
ment that is derived from indoor rid-
ing after a road experience.
>of .

The American Wife.

It is the fashior of certain writers and
lecturers to speak of the American
woman as a lily of the field. She toils
not, neither does she spin, and yet
Solomon, in all his glory, was not ar-
rayed like unto her. She is represented
as spending in prodigal extravagance
the dollars coined by a meek and over-
worked husband, as despising mother-
hood and domesticity, and never so
happy as when she waves adieu to hus-
band and home from the deck of an
ocean steamer. Contrasted with this
picture is that of the German house frau
sitting at work in the midst of her
maidens, the French mother, who is a
queen in her household and is satisfied
to know nothing of the great outer
world, and that tower of virtue and re-
spectability, the British matron, as she
checks over her butcher’s accounts
and calls on the cook to account for the
drippings of the meat.

It is unfortunately impossible to deny
the existence of the extravagant wom-
an, but she is not the exclusive product
of any nation, and does not represent
the great mass of the women of any
country. The woman who wears dia-
monds to breakfast and who® spends her
life in Europe, while her husband _ toils
at home to furnish the sinews of war, is
not representative of American wife-
hood, and any view which does not rep-
resent the American woman as a true
helpmeet to her husband is a very false
and superficial one.

It is true that the American woman is
not often found acting as her husband’s

cashier or head clerk, but she is at
home superintending the household,
mending, making, sewing, economiz-

ing, teaching her children, making one
dollar do the work of two. More than
that, she is ambitious, and she is study-
ing this or that, so that when fortune
comes she may be ready to take what-
ever good the gods provide. She knows
that the woman who began her married
life in a two-room shanty has lived to
queen it in a palace. She has seen
women who did their own washing and
took in boarders to help along receive
their reward in seeing their husbands
governors of states, or members of the
supreme court, or diplomats honored at
European courts. She knows that such
honors may be in store for her husband
and she must help him win them. No

 

man who had a weak or insignificant
wife ever fought his way up to the
top, and that so many American men
succeed is unanswerable proof that
American women are not, as a rule,
idle and extravagant. They are cften
the humble and unnoticed little tug that
conveys the stately ship into the desired
harbor.

If American women, with character-
istic national optimism, are always fit-
ting themselves for gocd fortune, they
bear evil with equal bravery and hope
in something better turning up. The
European woman, when she loses her
fortune, sinks under the blow into a
hired companion. The American wom-
an braces herself up and looks about for
something to do. She starts a fashion-
able boarding-house, she turns writer,
painter, actress—what not? She may
not have the slightest idea how to do
any of these things when she starts, but
she has grit and determination, pluck
and energy, and she will learn before
she is done. She will help her husband
get on his feet again if she can, she will
educate her sons and marry her daugh-
ters to her boarders, and the last estate
of that woman, nine times out of ten, is
better than the first.

The women, the wives of the early
settlers of this country, took an equal
share in work and danger and privation
with their husbands in colonizing the
new states. They endured every hard-
ship without a murmur, they helped
their husbands conquer the wilderness
and raised their children to be honest
men and pure women. If to-day it is
no longer for the American woman to
toil with her own hands, if her husband
delights to adorn her in silken raiment
and make her life soft and beautiful,
be suré the same womanhood underlies
it still, and still rings true metal when
tested. Wherever she is, she is true
wife and mother. Hardships do not
daunt her, scandal does not touch her,
and if she is too honest to cajole a man,
and too courageous to meekly follow
his lead, she is none the less a true and
loving helpmeet to the man who is her
husband and her friend.

+ «>

California wines will cost more this
year than in several years past, accord»
ing to the California Winemakers’ Cor-
poration. It is stated that the vintage
of 1895 was only 9,500,000 gallons of
dry wines, red and white, while in
the past few years the production has
been between 15,000,000 and 24,000,000
gallons. Some 6,000,000 gallons are
consumed on the Pacific coast and the
exports have usually been from 10,000, -
000 to 13,000,000 gallons, of ali kinds of
wine. Last year only 3,000,000 gallons
of sweet wines were made, making a
total vintage for the year of 12,500,000
gallons. There was little surplus stock
carried over from previous years. From
these facts the winemakers conclude
that the supply will be far below the
demand, and that high prices and good
times for them will result. _

 

yyevvvuvvvvvvvvvvvvyvyvyvvvvwvs
wveveVveCvrVvCCT CC TTT TTCT TTT

Il Put Ginger in Your Business

Experienced young man of 29,
wants to hustle for some wide-
awake (or dying) concern in
some large town orcity. Knows
that hard work will make busi-
ness. Can take entire manage-
ment of Dry Goods and Carpet
lines; run them with economy
and profit. What more could
you ask? To get better ac-
quuinted suppose you write
A MICHIGAN MAN,
Care TRADESMAN Co.

How’s the Upper Peninsula?

 

LHbohbbbb bh bh bb bb bbb b bata
i i he le ho hi ho ba ha ha ha bo a ha bn ha ha ho ha
S © 8 € & SG
hHboabdbdbdbh bb bh bbb bbbbobatt
FUG UV V GO OG VO VV VV UV VY

 

yevvvvvvvvvvrvvvvvvvvvvvv"s
www TT TT TTT.

 

 

 

WANTS COLUMN.
~ BUSINESS CHANCES.
KGOO Sock ’or groceries, including turn’

 

 

ture. Stock run six months and kept well as-
sorted. Don’t miss this. Owner wants to go
West.

Address No. 989, care Michigan Trades-
man. ig
GRAND CHANCE FOR A BAZAAR—UP-
per Peninsula mining town of 6,000 and no
bazaar. Will rent a building now used for a
grocery; room, 30x40, shelves, counters, show
cases. electric and gas light. Correspondence
solicited. Address N, care Michigan 'Trades-
man. 98
rTyVRO EXCHANGE—A DOUBLE STORE AND
stock of general merchandise for a good im-
proved farm. Store and stock will invoice 37,1100.
This is a rare chance to get a good paying busi-
ness. Address No. 984, care Michigan Trades-
man. 934
NOR SALE—ONE IRON FIREPROOF SAFE,
36x42 in. in dimensions, 4 ft. 6 in. in height,
with enclosed burglar proof steel chest; two
sets double doors and one of heavy steel; double
combination locks; weight, 7,500 pounds. Ad-
dress, for a bargain, D. M. Gardner, St. Louis,
Mich. 983
NOR SALE—GOOD CLEAN STOCK OF
clothing and furnishings in live Central
Michigan town. Address B. W. Hewitt, Maple
Rapids, Mich. 982
NOR SALE—DRUG STOCK; DOING A PAY-
ing business in a city of 2,500; will sell
cheap for cash, or part cash and balance time;
$2,000 stock; will sell at discount; no cut rates
here. Address H, care Michigan ——
978

STOCK ON

 

 

 

 

 

 

NOR SALE—CLEAN DRUG
best business street in Grand Rapids.
Established sixteen years. Terms, cash or
jrand Rapids real estate. Rent, reasonable.
Reason for selling, other business. Address
No. 968, care Michigan Tradesman. 968

ANTED—TO EXCHANGE GOOD GRAND
Rapids estate for stocks of merchandise.
Address No. 969, care Michigan Tradesman, 969
OR SALE—SMALL LIVERY STOvK IN
good town with good trade. Reason for
selling, other business. Address, No. 945, care
Michigan Tradesman. 948
NOR SALE—CLEAN GROCERY STOCK IN
city of 3,000 inhabitants. Stock and fixtures
will inventory about $1,500. Best location. Ad-
dress No. 933, Care Michigan Tradesman. 933
NOR SALE—STAPLE AND FANCY GRO-
eery stock, invoicing about $1,400, located in
live Southern Michigan town of 1,200inhabitants;
good trade, nearly all cash. Reasons forselling,
other business. Address No. 907, care Michigan
Tradesman. 907

OR SALE—A FIRST-CLASS HARDWARE

and implement business in thriving village

in good farming community. Address Brown &
Sehler, Grand Rapids, Mich.

MISCELLANEOUS.

GENTS—CANVASSERS CAN MAKE $810 TO
#20 day easy selling our Frozen Perfumes;
something new: everybody buys it. Stamp,
particulars. Frozen Perfume Co., 6388 Jackson
St., Chicago, Ill. 991
SS ANTED, EXPERIENCED
K) salesman to sell our high-grade lubricating
oils and greases. Liberal and satisfactory terms
will be made with a competent man. Equitable
Refining Co., Cleveland, Ohio. 987
ANTED—AGENTS TO CANVASS FOR
books: #6 to #10 a week salary paid; no
commission. Michigan Publishing Co., Cor-
unna, Mich. 990
so - TOCK OF GROCERIES OR
general stock in exchange for Grand Rap-
ids city lots.
Mich.

 

 

 

 

 

 

 

 

 

Address Ed. T. Cooley, Wacousta,
981

 

W exchange for 320 acres of timber, free title,
in Eastern Texas. Would prefer shoes or gro-
ceries. Address No. 980, care Michigan Trades-
man. 980
_..; LOCATION IN GOOD
town to start bakery. Address Box 166,
Baldwin, Mich. 979
ANTED—SITUATION IN OFFICE BY
young lady as draftsman, book-keeper or
any oftice work. Best references. Address No.
986, care Michigan Tradesman. 986
oC ... BY YOUNG MAN OF
good habits and with eight years’ expe-
rience in the grocery business. Can furnish good
references. Address W, care Michigan Trades-
man. 985

 

 

 

 

ANTED, BY APRIL 1—A LINE OF GOODS
for Lower Michigan or Upper Peninsula;
last six years in Upper Peninsula; the highest
reference to character and ability. Address No.
970, care Michigan Tradesman. — 970
ANTED—POSITION AS CLERK; NINE
years’ experience; good stock-keeper; can
attend to buying or take charge of store; good
references; thirty-two years old; married. Ad-
dress Box 115, Farwell, Mich. 971
O RENT—SECOND AND THIRD FLOORS
of Waldron block, opposite Union Depot,
South Ionia street. For right party will parti-
tion off into lodging rooms. Best location in
Grand Rapids. See John C. Dunton, 63 Lyon St.
975
eee ASSISTANT
pharmacist. Address No. 977, care Mich-
igan Tradesman. 977
ANTED TO CORRESPOND WITH SHIP-

pers of butter and eggs and other season-
able produce. R. Hirt, 36 Market street, Detroit.
9

 

 

 

 

 

W JANTED—SITUATION AS REGISTERED
pharmacist, first-class references. Ad-
dress No. 940, care Michigan Tradesman. 940

ANTED—SEVERAL MICHIGAN’ CEN-
tral mileage books. Address, stating
price, Vindex, care Michigan Tradesman.